Mutagenetix > Incidental Mutation

Incidental Mutation 'R6155:Sptbn1'

489530

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

non-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2

MMRRC Submission

044302-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30099395-30268175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 30137403 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 999 (L999R)

Ref Sequence

ENSEMBL: ENSMUSP00000099902 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

AlphaFold

Q62261

Predicted Effect

probably damaging
Transcript: ENSMUST00000006629
AA Change: L1012R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: L1012R

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000011877
AA Change: L1012R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: L1012R

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102838
AA Change: L999R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: L999R

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124231
AA Change: L1012R

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: L1012R

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Meta Mutation Damage Score

0.6881

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actn4	A	C	7: 28,896,141	I763S	probably damaging	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
Dock2	C	G	11: 34,294,123	M1072I	probably benign	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Map3k5	A	T	10: 20,118,441	H1027L	probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas2	G	A	1: 39,287,476	R14Q	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Olfr749	T	C	14: 50,736,619	D181G	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,479,125		probably null	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Tpp2	T	A	1: 43,956,489	V268E	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30110818	nonsense	probably null
IGL01098:Sptbn1	APN	11	30159385	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30104623	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30145979	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30138496	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30100659	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30137427	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30117871	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30120990	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30142129	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30119491	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30142293	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30137239	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30197747	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30142247	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30142289	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30121545	missense	probably benign
R0389:Sptbn1	UTSW	11	30139250	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30149576	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30145985	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30150008	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30138979	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30117903	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30110902	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30139016	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30142201	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30121591	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30120785	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30138637	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30113909	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30121498	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30137301	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30120783	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30142245	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30159371	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30136124	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30114781	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30142414	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30104469	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30104559	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30159293	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30138360	splice site	probably benign
R2312:Sptbn1	UTSW	11	30154249	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30219686	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30140593	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30137335	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30142329	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30139114	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30219597	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30100660	missense	probably benign
R4707:Sptbn1	UTSW	11	30137197	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30154297	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30117759	missense	probably benign
R4824:Sptbn1	UTSW	11	30118295	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30142353	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30124016	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30113854	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30121510	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30137364	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30100520	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30137560	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30143174	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30144113	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30145941	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30145925	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30123978	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30136136	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30124873	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30118464	missense	probably damaging	1.00
R6163:Sptbn1	UTSW	11	30159443	nonsense	probably null
R6226:Sptbn1	UTSW	11	30136054	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30100660	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30139429	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30124030	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30117859	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30114787	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30146777	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30138634	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30142187	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30100633	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30103323	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30137119	missense	possibly damaging	0.75
R7272:Sptbn1	UTSW	11	30114859	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30117798	nonsense	probably null
R7379:Sptbn1	UTSW	11	30139292	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30142142	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30138455	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30138832	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30154320	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30142153	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30129601	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30136048	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30101616	missense	probably damaging	0.99
R8116:Sptbn1	UTSW	11	30139117	missense	probably damaging	1.00
R8169:Sptbn1	UTSW	11	30197783	missense	possibly damaging	0.62
R8208:Sptbn1	UTSW	11	30124972	missense	probably damaging	1.00
R8247:Sptbn1	UTSW	11	30113906	missense	possibly damaging	0.84
R8412:Sptbn1	UTSW	11	30138457	missense	probably damaging	1.00
R8470:Sptbn1	UTSW	11	30120758	missense	possibly damaging	0.78
R8544:Sptbn1	UTSW	11	30219750	start gained	probably benign
R8674:Sptbn1	UTSW	11	30139352	missense	possibly damaging	0.73
R8846:Sptbn1	UTSW	11	30125009	missense	possibly damaging	0.77
R8889:Sptbn1	UTSW	11	30117800	missense	probably benign	0.03
R8892:Sptbn1	UTSW	11	30117800	missense	probably benign	0.03
R8927:Sptbn1	UTSW	11	30138962	missense	probably damaging	1.00
R8928:Sptbn1	UTSW	11	30138962	missense	probably damaging	1.00
R8975:Sptbn1	UTSW	11	30123869	missense	possibly damaging	0.86
R9115:Sptbn1	UTSW	11	30137526	missense	probably damaging	1.00
R9127:Sptbn1	UTSW	11	30154356	missense	probably damaging	1.00
R9193:Sptbn1	UTSW	11	30137551	missense	possibly damaging	0.77
R9237:Sptbn1	UTSW	11	30146803	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30137439	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30197787	missense	probably benign	0.13
Z1177:Sptbn1	UTSW	11	30114734	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30120659	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CAGAAACTGCTGCAGCTTGC -3'
(R):5'- CAGGTGGAGTCAGTTCAGAG -3'

Sequencing Primer
(F):5'- TGCAGCTTGCTGGCCTC -3'
(R):5'- GAAAAAGGATGCTCTTCTGTCTGCC -3'

Posted On

2017-10-10