Mutagenetix > Incidental Mutations

Incidental Mutation 'R6155:Dock2'

489531

Institutional Source

Beutler Lab

Gene Symbol

Dock2

Ensembl Gene

ENSMUSG00000020143

Gene Name

dedicator of cyto-kinesis 2

Synonyms

CED-5, MBC, Hch

MMRRC Submission

044302-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34226815-34783892 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 34294123 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 1072 (M1072I)

Ref Sequence

ENSEMBL: ENSMUSP00000090884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093193] [ENSMUST00000101365]

Predicted Effect

probably benign
Transcript: ENSMUST00000093193
AA Change: M1072I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: M1072I

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	2e-113	PFAM
Pfam:DOCK-C2	419	616	1e-60	PFAM
Pfam:DHR-2	1114	1614	6.3e-96	PFAM
low complexity region	1691	1706	N/A	INTRINSIC
low complexity region	1793	1800	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101365
AA Change: M1072I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143
AA Change: M1072I

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	1.4e-113	PFAM
Pfam:DOCK-C2	419	616	5.5e-61	PFAM
low complexity region	1163	1171	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actn4	A	C	7: 28,896,141	I763S	probably damaging	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Map3k5	A	T	10: 20,118,441	H1027L	probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas2	G	A	1: 39,287,476	R14Q	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Olfr749	T	C	14: 50,736,619	D181G	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,479,125		probably null	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,137,403	L999R	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Tpp2	T	A	1: 43,956,489	V268E	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Dock2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Dock2	APN	11	34704661	missense	probably damaging	1.00
IGL00469:Dock2	APN	11	34229603	splice site	probably benign
IGL01061:Dock2	APN	11	34705826	missense	probably damaging	1.00
IGL01319:Dock2	APN	11	34698790	missense	possibly damaging	0.61
IGL01451:Dock2	APN	11	34310390	missense	probably damaging	1.00
IGL01490:Dock2	APN	11	34705781	missense	probably damaging	0.97
IGL01601:Dock2	APN	11	34239528	critical splice donor site	probably null
IGL01800:Dock2	APN	11	34756273	missense	probably damaging	1.00
IGL01804:Dock2	APN	11	34262433	missense	probably benign	0.01
IGL01823:Dock2	APN	11	34262391	missense	probably damaging	1.00
IGL01829:Dock2	APN	11	34705841	missense	probably damaging	0.98
IGL01830:Dock2	APN	11	34691917	nonsense	probably null
IGL01835:Dock2	APN	11	34310435	missense	possibly damaging	0.51
IGL01845:Dock2	APN	11	34708865	missense	probably benign	0.02
IGL01953:Dock2	APN	11	34732356	missense	probably benign	0.28
IGL01989:Dock2	APN	11	34268053	missense	probably benign
IGL02081:Dock2	APN	11	34254355	missense	probably benign
IGL02105:Dock2	APN	11	34714525	missense	probably damaging	1.00
IGL02153:Dock2	APN	11	34230670	missense	probably benign	0.01
IGL02170:Dock2	APN	11	34267949	missense	probably damaging	1.00
IGL02344:Dock2	APN	11	34731510	missense	probably damaging	0.98
IGL02389:Dock2	APN	11	34698740	splice site	probably benign
IGL02409:Dock2	APN	11	34501204	missense	probably benign	0.00
IGL02472:Dock2	APN	11	34249801	missense	probably benign	0.00
IGL02625:Dock2	APN	11	34501168	critical splice donor site	probably null
IGL02929:Dock2	APN	11	34268048	missense	probably damaging	1.00
IGL02951:Dock2	APN	11	34310448	unclassified	probably benign
IGL02999:Dock2	APN	11	34692259	missense	probably damaging	0.99
IGL03165:Dock2	APN	11	34687533	missense	probably damaging	0.99
Arches	UTSW	11	34689760	missense	probably damaging	1.00
capitol_reef	UTSW	11	34294170	critical splice acceptor site	probably null
Croesus	UTSW	11	34721027	missense	probably damaging	1.00
denali	UTSW	11	34229472	critical splice donor site	probably null
dew	UTSW	11	34248636	nonsense	probably null
Dry	UTSW	11	34231652	missense	possibly damaging	0.79
frazz	UTSW	11	34248572	critical splice donor site	probably benign
frizz	UTSW	11	34258184	splice site	probably benign
gildenstern	UTSW	11	34732339	critical splice donor site	probably null
godsgrace	UTSW	11	34695453	missense	probably damaging	1.00
Harborside	UTSW	11	34262445	missense	probably benign
Landing	UTSW	11	34714501	missense	possibly damaging	0.83
latest	UTSW	11	34756222	missense	probably damaging	1.00
Launch	UTSW	11	34256562	missense	probably damaging	1.00
liaoning	UTSW	11	34708793	missense	probably damaging	1.00
midas	UTSW	11	34294323	missense	probably damaging	0.99
muelle	UTSW	11	34687538	missense	probably damaging	1.00
narrowest	UTSW	11	34282652	missense	probably damaging	0.98
pier	UTSW	11	34689766	missense	probably damaging	1.00
Plank	UTSW	11	34783795	missense	possibly damaging	0.51
riches	UTSW	11	34688452	critical splice donor site	probably null
skiff	UTSW	11	34262388	missense	probably null	0.80
Slip	UTSW	11	34294286	missense	probably benign	0.25
toothskin	UTSW	11	34464922	missense	probably damaging	1.00
Touch	UTSW	11	34273750	missense	possibly damaging	0.95
wassup	UTSW	11	34503413	missense	probably damaging	1.00
Wharf	UTSW	11	34732371	missense	possibly damaging	0.81
BB009:Dock2	UTSW	11	34267998	missense	probably benign	0.00
BB019:Dock2	UTSW	11	34267998	missense	probably benign	0.00
IGL03052:Dock2	UTSW	11	34232853	missense	probably benign	0.01
PIT4377001:Dock2	UTSW	11	34721008	missense	probably benign	0.02
R0006:Dock2	UTSW	11	34312453	unclassified	probably benign
R0012:Dock2	UTSW	11	34783795	missense	possibly damaging	0.51
R0063:Dock2	UTSW	11	34756284	critical splice acceptor site	probably null
R0063:Dock2	UTSW	11	34756284	critical splice acceptor site	probably null
R0116:Dock2	UTSW	11	34688565	intron	probably benign
R0149:Dock2	UTSW	11	34438327	missense	probably damaging	1.00
R0361:Dock2	UTSW	11	34438327	missense	probably damaging	1.00
R0462:Dock2	UTSW	11	34268052	missense	possibly damaging	0.74
R0471:Dock2	UTSW	11	34688553	missense	probably benign	0.30
R0538:Dock2	UTSW	11	34704718	splice site	probably benign
R0543:Dock2	UTSW	11	34294325	missense	probably damaging	1.00
R0660:Dock2	UTSW	11	34248621	missense	probably damaging	1.00
R0676:Dock2	UTSW	11	34695236	missense	probably damaging	0.99
R0722:Dock2	UTSW	11	34464970	splice site	probably benign
R0801:Dock2	UTSW	11	34708793	missense	probably damaging	1.00
R1110:Dock2	UTSW	11	34256535	missense	possibly damaging	0.78
R1171:Dock2	UTSW	11	34695241	missense	probably damaging	1.00
R1387:Dock2	UTSW	11	34273309	splice site	probably benign
R1445:Dock2	UTSW	11	34239705	missense	probably benign
R1494:Dock2	UTSW	11	34282761	nonsense	probably null
R1589:Dock2	UTSW	11	34706461	missense	probably damaging	0.99
R1597:Dock2	UTSW	11	34704647	missense	probably benign	0.00
R1629:Dock2	UTSW	11	34262480	splice site	probably null
R1749:Dock2	UTSW	11	34232767	critical splice donor site	probably null
R1888:Dock2	UTSW	11	34707342	missense	probably damaging	1.00
R1888:Dock2	UTSW	11	34707342	missense	probably damaging	1.00
R1899:Dock2	UTSW	11	34294286	missense	probably benign	0.25
R1924:Dock2	UTSW	11	34464934	missense	possibly damaging	0.69
R2031:Dock2	UTSW	11	34727470	splice site	probably benign
R2045:Dock2	UTSW	11	34294106	splice site	probably null
R2098:Dock2	UTSW	11	34266279	missense	probably benign	0.16
R2098:Dock2	UTSW	11	34719005	missense	probably damaging	0.99
R2129:Dock2	UTSW	11	34727415	missense	probably damaging	1.00
R2147:Dock2	UTSW	11	34229472	critical splice donor site	probably null
R2149:Dock2	UTSW	11	34229472	critical splice donor site	probably null
R2150:Dock2	UTSW	11	34229472	critical splice donor site	probably null
R2176:Dock2	UTSW	11	34695217	missense	probably benign	0.00
R2230:Dock2	UTSW	11	34294323	missense	probably damaging	0.99
R2508:Dock2	UTSW	11	34312485	missense	probably benign	0.04
R2875:Dock2	UTSW	11	34718885	missense	probably damaging	1.00
R2885:Dock2	UTSW	11	34689766	missense	probably damaging	1.00
R2910:Dock2	UTSW	11	34232910	splice site	probably benign
R3081:Dock2	UTSW	11	34231610	missense	probably benign
R3418:Dock2	UTSW	11	34689760	missense	probably damaging	1.00
R3552:Dock2	UTSW	11	34720960	missense	probably benign	0.22
R3731:Dock2	UTSW	11	34708895	missense	probably damaging	1.00
R3846:Dock2	UTSW	11	34732371	missense	possibly damaging	0.81
R4135:Dock2	UTSW	11	34714501	missense	possibly damaging	0.83
R4598:Dock2	UTSW	11	34239536	missense	probably damaging	1.00
R4599:Dock2	UTSW	11	34239536	missense	probably damaging	1.00
R4715:Dock2	UTSW	11	34294118	missense	probably damaging	1.00
R4722:Dock2	UTSW	11	34695471	missense	probably damaging	1.00
R4742:Dock2	UTSW	11	34294170	critical splice acceptor site	probably null
R4830:Dock2	UTSW	11	34273767	splice site	probably null
R4884:Dock2	UTSW	11	34266248	missense	probably damaging	1.00
R4990:Dock2	UTSW	11	34695251	missense	probably damaging	1.00
R5334:Dock2	UTSW	11	34228643	missense	probably benign	0.00
R5570:Dock2	UTSW	11	34727406	missense	probably damaging	1.00
R5602:Dock2	UTSW	11	34254391	missense	probably benign	0.16
R5681:Dock2	UTSW	11	34249836	missense	probably benign	0.06
R5809:Dock2	UTSW	11	34262445	missense	probably benign
R5860:Dock2	UTSW	11	34256562	missense	probably damaging	1.00
R6111:Dock2	UTSW	11	34708787	missense	probably damaging	0.99
R6156:Dock2	UTSW	11	34247789	missense	possibly damaging	0.51
R6173:Dock2	UTSW	11	34262388	missense	probably null	0.80
R6182:Dock2	UTSW	11	34229476	missense	probably damaging	0.97
R6188:Dock2	UTSW	11	34503396	missense	probably damaging	0.98
R6191:Dock2	UTSW	11	34231652	missense	possibly damaging	0.79
R6283:Dock2	UTSW	11	34707325	missense	probably damaging	0.99
R6395:Dock2	UTSW	11	34232874	missense	probably damaging	1.00
R6465:Dock2	UTSW	11	34503413	missense	probably damaging	1.00
R6500:Dock2	UTSW	11	34362822	missense	possibly damaging	0.76
R6561:Dock2	UTSW	11	34687538	missense	probably damaging	1.00
R6745:Dock2	UTSW	11	34705842	missense	probably damaging	1.00
R6745:Dock2	UTSW	11	34705843	missense	probably damaging	1.00
R6880:Dock2	UTSW	11	34688452	critical splice donor site	probably null
R6913:Dock2	UTSW	11	34756222	missense	probably damaging	1.00
R6997:Dock2	UTSW	11	34464922	missense	probably damaging	1.00
R7057:Dock2	UTSW	11	34227684	missense	probably benign	0.10
R7057:Dock2	UTSW	11	34695217	missense	probably benign	0.00
R7134:Dock2	UTSW	11	34310363	missense	probably benign	0.03
R7188:Dock2	UTSW	11	34239675	missense	possibly damaging	0.87
R7239:Dock2	UTSW	11	34231677	missense	probably benign	0.00
R7247:Dock2	UTSW	11	34714513	nonsense	probably null
R7250:Dock2	UTSW	11	34695205	missense	probably benign	0.01
R7250:Dock2	UTSW	11	34695293	missense	probably damaging	1.00
R7271:Dock2	UTSW	11	34273750	missense	possibly damaging	0.95
R7284:Dock2	UTSW	11	34230672	missense	probably benign	0.01
R7397:Dock2	UTSW	11	34718989	missense	probably benign	0.00
R7464:Dock2	UTSW	11	34695278	missense	probably damaging	0.99
R7512:Dock2	UTSW	11	34312542	missense	possibly damaging	0.95
R7556:Dock2	UTSW	11	34720951	missense	probably benign	0.43
R7663:Dock2	UTSW	11	34721027	missense	probably damaging	1.00
R7779:Dock2	UTSW	11	34714455	missense	probably benign	0.38
R7797:Dock2	UTSW	11	34282652	missense	probably damaging	0.98
R7855:Dock2	UTSW	11	34273698	missense	probably damaging	1.00
R7922:Dock2	UTSW	11	34707327	missense	probably benign	0.29
R7932:Dock2	UTSW	11	34267998	missense	probably benign	0.00
R8013:Dock2	UTSW	11	34705850	missense	probably damaging	0.96
R8192:Dock2	UTSW	11	34732339	critical splice donor site	probably null
R8244:Dock2	UTSW	11	34695453	missense	probably damaging	1.00
R8307:Dock2	UTSW	11	34310362	missense	possibly damaging	0.95
R8418:Dock2	UTSW	11	34718968	missense	probably benign	0.01
R8460:Dock2	UTSW	11	34230825	critical splice acceptor site	probably null
R8495:Dock2	UTSW	11	34231622	missense	probably benign	0.14
R8556:Dock2	UTSW	11	34262457	missense	possibly damaging	0.84
R8690:Dock2	UTSW	11	34727460	nonsense	probably null
R8743:Dock2	UTSW	11	34273252	nonsense	probably null
R8757:Dock2	UTSW	11	34695240	missense	probably benign	0.13
R8759:Dock2	UTSW	11	34695240	missense	probably benign	0.13
R8793:Dock2	UTSW	11	34501215	missense	probably benign	0.00
X0017:Dock2	UTSW	11	34266271	missense	probably benign	0.08
X0018:Dock2	UTSW	11	34232833	missense	possibly damaging	0.65
X0058:Dock2	UTSW	11	34256564	missense	probably damaging	1.00
X0066:Dock2	UTSW	11	34310357	missense	possibly damaging	0.95
Z1088:Dock2	UTSW	11	34438300	missense	probably benign	0.14
Z1088:Dock2	UTSW	11	34692382	missense	probably damaging	1.00
Z1088:Dock2	UTSW	11	34695212	nonsense	probably null
Z1176:Dock2	UTSW	11	34718924	missense	probably benign	0.04
Z1177:Dock2	UTSW	11	34312553	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGCATGACAACAGTTCTCACAC -3'
(R):5'- ATCACTCAGGACTCTCTGCAGC -3'

Sequencing Primer
(F):5'- AGTTCTCACACCAGCCCTG -3'
(R):5'- AGCTGGAGCAGTTCACAC -3'

Posted On

2017-10-10