Incidental Mutation 'R6155:Gabra6'
ID 489532
Institutional Source Beutler Lab
Gene Symbol Gabra6
Ensembl Gene ENSMUSG00000020428
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6
Synonyms Gabra-6, alpha6, GABA-ARalpha6
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 42306437-42321072 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42316523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 245 (I245F)
Ref Sequence ENSEMBL: ENSMUSP00000126114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020703] [ENSMUST00000109286] [ENSMUST00000155218]
AlphaFold P16305
Predicted Effect probably damaging
Transcript: ENSMUST00000020703
AA Change: I235F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020703
Gene: ENSMUSG00000020428
AA Change: I235F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 230 2.4e-43 PFAM
Pfam:Neur_chan_memb 237 378 9.3e-43 PFAM
transmembrane domain 413 430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109286
AA Change: I244F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104909
Gene: ENSMUSG00000020428
AA Change: I244F

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 31 239 2.4e-53 PFAM
Pfam:Neur_chan_memb 246 387 9.7e-43 PFAM
transmembrane domain 422 439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155218
AA Change: I245F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126114
Gene: ENSMUSG00000020428
AA Change: I245F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 240 2e-51 PFAM
Pfam:Neur_chan_memb 247 393 6.3e-35 PFAM
transmembrane domain 423 440 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal cerebellar cytoarchitecture and normal responses to ethanol, pentobarbital and general anesthetics. Mice homozygous for a reporter allele are behaviorally normal and lack a cochlear phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Gabra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gabra6 APN 11 42317023 missense probably damaging 1.00
IGL01553:Gabra6 APN 11 42315196 missense probably damaging 1.00
IGL01801:Gabra6 APN 11 42315108 missense probably damaging 1.00
IGL02474:Gabra6 APN 11 42307417 missense probably benign
IGL03027:Gabra6 APN 11 42315153 missense probably damaging 1.00
IGL03111:Gabra6 APN 11 42317017 missense probably damaging 1.00
R0121:Gabra6 UTSW 11 42314971 missense probably benign
R0206:Gabra6 UTSW 11 42317079 nonsense probably null
R0240:Gabra6 UTSW 11 42314947 missense probably benign 0.01
R0726:Gabra6 UTSW 11 42315127 missense probably damaging 0.98
R0745:Gabra6 UTSW 11 42316567 missense probably damaging 0.99
R0751:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R0789:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R1666:Gabra6 UTSW 11 42317634 missense probably damaging 1.00
R1754:Gabra6 UTSW 11 42316561 missense probably damaging 1.00
R2317:Gabra6 UTSW 11 42317780 critical splice acceptor site probably null
R3605:Gabra6 UTSW 11 42314950 missense probably benign 0.00
R4647:Gabra6 UTSW 11 42307372 missense probably damaging 1.00
R5566:Gabra6 UTSW 11 42307490 missense probably benign
R5929:Gabra6 UTSW 11 42317562 missense probably damaging 0.99
R5930:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R5931:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R7249:Gabra6 UTSW 11 42317432 missense probably damaging 1.00
R7759:Gabra6 UTSW 11 42317681 missense probably damaging 1.00
R7783:Gabra6 UTSW 11 42316462 missense probably damaging 1.00
R7794:Gabra6 UTSW 11 42321041 splice site probably null
R7869:Gabra6 UTSW 11 42316495 missense possibly damaging 0.96
R7949:Gabra6 UTSW 11 42316999 missense probably benign 0.07
R8199:Gabra6 UTSW 11 42316453 missense probably damaging 1.00
R8692:Gabra6 UTSW 11 42319710 missense probably damaging 1.00
R8954:Gabra6 UTSW 11 42315132 missense probably damaging 1.00
R9076:Gabra6 UTSW 11 42307462 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCACAGTTGTCAGTATTCACAGC -3'
(R):5'- CTAACTGGTATGTGTCTTTACATCC -3'

Sequencing Primer
(F):5'- CAGTTGTCAGTATTCACAGCAAAATC -3'
(R):5'- CTGGTATGTGTCTTTACATCCAATTG -3'
Posted On 2017-10-10