Incidental Mutation 'R6155:Slc35b3'
ID 489539
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Name solute carrier family 35, member B3
Synonyms PAPST2, 4921526O06Rik
MMRRC Submission 044302-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.635) question?
Stock # R6155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 39116112-39144851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39128572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 30 (S30T)
Ref Sequence ENSEMBL: ENSMUSP00000153485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225432] [ENSMUST00000225568] [ENSMUST00000225461] [ENSMUST00000225714] [ENSMUST00000225331] [ENSMUST00000225396]
AlphaFold Q922Q5
Predicted Effect possibly damaging
Transcript: ENSMUST00000021870
AA Change: S172T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432
AA Change: S172T

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167513
AA Change: S128T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432
AA Change: S128T

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223619
Predicted Effect probably benign
Transcript: ENSMUST00000224429
Predicted Effect probably benign
Transcript: ENSMUST00000224645
Predicted Effect probably damaging
Transcript: ENSMUST00000225432
AA Change: S128T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225568
AA Change: S30T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225461
Predicted Effect probably benign
Transcript: ENSMUST00000225714
Predicted Effect probably benign
Transcript: ENSMUST00000225331
Predicted Effect probably benign
Transcript: ENSMUST00000225396
Meta Mutation Damage Score 0.5147 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 105,111,510 (GRCm39) Y319C probably benign Het
Actn4 A C 7: 28,595,566 (GRCm39) I763S probably damaging Het
Actr8 G A 14: 29,700,546 (GRCm39) probably null Het
Adrb1 T C 19: 56,711,336 (GRCm39) L178P probably damaging Het
Afap1 A G 5: 36,092,953 (GRCm39) Y19C unknown Het
Ankrd36 A G 11: 5,637,442 (GRCm39) E1337G probably benign Het
Arl4a A C 12: 40,086,519 (GRCm39) V76G probably damaging Het
Bmp1 A T 14: 70,745,447 (GRCm39) I246K probably damaging Het
Camk4 A T 18: 33,072,500 (GRCm39) T18S unknown Het
Cep152 T C 2: 125,423,620 (GRCm39) H927R probably benign Het
Clca3a2 A G 3: 144,525,118 (GRCm39) I38T probably damaging Het
Clec2g A C 6: 128,957,236 (GRCm39) T54P probably damaging Het
Cox20 A G 1: 178,149,362 (GRCm39) E31G possibly damaging Het
Crispld1 T A 1: 17,823,241 (GRCm39) H407Q probably benign Het
Csmd1 T C 8: 15,953,231 (GRCm39) I3417V probably benign Het
Dhtkd1 A C 2: 5,915,170 (GRCm39) H700Q probably null Het
Dnah10 G A 5: 124,847,663 (GRCm39) V1516M probably damaging Het
Dnah10 A G 5: 124,862,239 (GRCm39) T2165A probably damaging Het
Dock2 C G 11: 34,244,123 (GRCm39) M1072I probably benign Het
F11 T A 8: 45,705,119 (GRCm39) T141S probably damaging Het
Gabra6 T A 11: 42,207,350 (GRCm39) I245F probably damaging Het
H2-T5 G A 17: 36,478,399 (GRCm39) A211V possibly damaging Het
Herc1 T A 9: 66,340,705 (GRCm39) C1685S possibly damaging Het
Iftap A T 2: 101,406,355 (GRCm39) probably null Het
Il20 G T 1: 130,838,477 (GRCm39) D73E probably damaging Het
Ireb2 C A 9: 54,793,811 (GRCm39) P247Q probably damaging Het
Kcng3 T C 17: 83,895,807 (GRCm39) I220V probably benign Het
Lce1j T G 3: 92,696,379 (GRCm39) Q133P unknown Het
Lgals9 C T 11: 78,854,331 (GRCm39) A287T probably benign Het
Lrrc52 A G 1: 167,294,296 (GRCm39) probably benign Het
Map3k5 A T 10: 19,994,187 (GRCm39) H1027L probably benign Het
Morc3 A G 16: 93,659,313 (GRCm39) D407G possibly damaging Het
Myom1 T C 17: 71,415,690 (GRCm39) probably null Het
Ncapg2 T C 12: 116,401,631 (GRCm39) F673S possibly damaging Het
Ncoa6 T C 2: 155,249,368 (GRCm39) D1312G probably damaging Het
Nkx1-1 A T 5: 33,588,395 (GRCm39) F298I probably damaging Het
Npas2 G A 1: 39,326,557 (GRCm39) R14Q probably damaging Het
Npas4 C T 19: 5,036,898 (GRCm39) C422Y probably damaging Het
Or11h4 T C 14: 50,974,076 (GRCm39) D181G probably benign Het
Or2y11 T A 11: 49,443,411 (GRCm39) I279N possibly damaging Het
Or4c123 A G 2: 89,126,765 (GRCm39) L283S probably damaging Het
Or5p4 T C 7: 107,680,493 (GRCm39) V164A probably benign Het
Pcdhga4 T C 18: 37,819,546 (GRCm39) I365T probably damaging Het
Pear1 T A 3: 87,666,875 (GRCm39) T37S probably damaging Het
Pkn2 A T 3: 142,559,454 (GRCm39) F24I probably benign Het
Plcb3 G A 19: 6,943,533 (GRCm39) A122V probably damaging Het
Pnliprp1 T C 19: 58,718,565 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,712 (GRCm39) H337L probably benign Het
Psmb3 T A 11: 97,603,278 (GRCm39) F164I probably damaging Het
Ptch2 T A 4: 116,954,105 (GRCm39) F45Y probably damaging Het
Ptpn23 C A 9: 110,216,849 (GRCm39) probably benign Het
Pusl1 A G 4: 155,975,005 (GRCm39) S199P probably damaging Het
Rasgrp2 C A 19: 6,452,531 (GRCm39) L35I probably damaging Het
Rictor T C 15: 6,823,458 (GRCm39) L1545P probably benign Het
Rtn4r A T 16: 17,969,258 (GRCm39) M229L probably benign Het
Ruvbl1 A T 6: 88,456,107 (GRCm39) probably null Het
Sorcs3 T C 19: 48,387,136 (GRCm39) V207A possibly damaging Het
Sox13 A G 1: 133,321,005 (GRCm39) S2P probably damaging Het
Sptbn1 A C 11: 30,087,403 (GRCm39) L999R probably damaging Het
Taf4 A G 2: 179,555,317 (GRCm39) V1015A probably damaging Het
Top3b T C 16: 16,709,373 (GRCm39) L687P probably damaging Het
Tpp2 T A 1: 43,995,649 (GRCm39) V268E probably damaging Het
Ttc6 T C 12: 57,784,402 (GRCm39) Y1824H possibly damaging Het
Txk A G 5: 72,858,069 (GRCm39) Y360H probably damaging Het
Vmn2r57 T C 7: 41,078,114 (GRCm39) I115V probably benign Het
Vmn2r98 T C 17: 19,286,143 (GRCm39) S214P possibly damaging Het
Zbtb48 T C 4: 152,106,495 (GRCm39) probably null Het
Zzz3 A G 3: 152,133,319 (GRCm39) I126V possibly damaging Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 39,127,116 (GRCm39) missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 39,139,758 (GRCm39) missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 39,121,251 (GRCm39) missense probably benign 0.09
R1170:Slc35b3 UTSW 13 39,121,307 (GRCm39) missense probably benign 0.03
R1440:Slc35b3 UTSW 13 39,138,110 (GRCm39) nonsense probably null
R1653:Slc35b3 UTSW 13 39,139,774 (GRCm39) missense probably benign 0.02
R1900:Slc35b3 UTSW 13 39,144,587 (GRCm39) critical splice donor site probably null
R3874:Slc35b3 UTSW 13 39,127,044 (GRCm39) missense possibly damaging 0.66
R3897:Slc35b3 UTSW 13 39,118,739 (GRCm39) missense probably benign 0.09
R4399:Slc35b3 UTSW 13 39,121,791 (GRCm39) missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 39,116,887 (GRCm39) missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 39,116,866 (GRCm39) missense probably benign 0.08
R5034:Slc35b3 UTSW 13 39,127,134 (GRCm39) missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 39,121,734 (GRCm39) missense probably damaging 0.98
R6663:Slc35b3 UTSW 13 39,138,112 (GRCm39) missense probably damaging 0.99
R7701:Slc35b3 UTSW 13 39,128,611 (GRCm39) missense probably benign 0.03
R8534:Slc35b3 UTSW 13 39,128,566 (GRCm39) missense probably benign 0.17
R8796:Slc35b3 UTSW 13 39,121,722 (GRCm39) critical splice donor site probably benign
R8950:Slc35b3 UTSW 13 39,138,097 (GRCm39) missense probably damaging 1.00
R9185:Slc35b3 UTSW 13 39,123,958 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- GAACTCAGTTGTGGACATTTGATTG -3'
(R):5'- TGTACCGATAAGCAGTGTTACAAC -3'

Sequencing Primer
(F):5'- GATTGTTTTTCCTAATGCCAGATGC -3'
(R):5'- TGACATTTTAAACGTATGCTTCCAG -3'
Posted On 2017-10-10