Mutagenetix > Incidental Mutations

Incidental Mutation 'R6155:Olfr749'

489541

Institutional Source

Beutler Lab

Gene Symbol

Olfr749

Ensembl Gene

ENSMUSG00000059069

Gene Name

olfactory receptor 749

Synonyms

GA_x6K02T2PMLR-6484046-6483105, MOR106-1

MMRRC Submission

044302-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

50736171-50745094 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50736619 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 181 (D181G)

Ref Sequence

ENSEMBL: ENSMUSP00000150627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074674] [ENSMUST00000214290]

Predicted Effect

probably benign
Transcript: ENSMUST00000074674
AA Change: D181G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000074242
Gene: ENSMUSG00000059069
AA Change: D181G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	5.2e-53	PFAM
Pfam:7tm_1	40	289	7.3e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214290
AA Change: D181G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: A reporter allele shows expression of this olfactory receptor by embryonic day 15.5 and throughout olfactory development there is an increase in the numbers of expressing olfactory sensory neurons with expression localized to the dorsal main olfactory epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actn4	A	C	7: 28,896,141	I763S	probably damaging	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
Dock2	C	G	11: 34,294,123	M1072I	probably benign	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Map3k5	A	T	10: 20,118,441	H1027L	probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas2	G	A	1: 39,287,476	R14Q	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,479,125		probably null	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,137,403	L999R	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Tpp2	T	A	1: 43,956,489	V268E	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Olfr749

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03188:Olfr749	APN	14	50736858	nonsense	probably null
R0141:Olfr749	UTSW	14	50736383	missense	possibly damaging	0.94
R0462:Olfr749	UTSW	14	50737097	missense	probably benign
R1424:Olfr749	UTSW	14	50737064	missense	probably benign
R1791:Olfr749	UTSW	14	50736687	small insertion	probably benign
R1912:Olfr749	UTSW	14	50736778	missense	probably damaging	1.00
R2069:Olfr749	UTSW	14	50736576	missense	possibly damaging	0.51
R2171:Olfr749	UTSW	14	50736419	missense	probably benign	0.33
R2176:Olfr749	UTSW	14	50736224	missense	probably benign
R2184:Olfr749	UTSW	14	50736602	missense	probably damaging	0.98
R3158:Olfr749	UTSW	14	50736814	missense	probably benign	0.01
R5068:Olfr749	UTSW	14	50737074	missense	probably benign	0.02
R5069:Olfr749	UTSW	14	50737074	missense	probably benign	0.02
R5070:Olfr749	UTSW	14	50737074	missense	probably benign	0.02
R5733:Olfr749	UTSW	14	50737052	missense	probably benign	0.32
R6728:Olfr749	UTSW	14	50736839	missense	possibly damaging	0.61
R7033:Olfr749	UTSW	14	50736707	missense	possibly damaging	0.78
R7276:Olfr749	UTSW	14	50736730	missense	possibly damaging	0.90
R7535:Olfr749	UTSW	14	50736665	missense	probably benign	0.37
R8124:Olfr749	UTSW	14	50736286	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACCACAGGTAGAGAAGGCCTTTC -3'
(R):5'- AACTGAATGTCTCTTCCTGGC -3'

Sequencing Primer
(F):5'- TAGAGAAGGCCTTTCGTCGGC -3'
(R):5'- ATAGGTACCTGGCCATTTGC -3'

Posted On

2017-10-10