Incidental Mutation 'R6155:Vmn2r98'
ID489547
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6155 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19065881 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 214 (S214P)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170424
AA Change: S214P

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: S214P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTTGAAACTTGCAGGCCTAAC -3'
(R):5'- TACCTTCTAGTGAATCAATGTCACC -3'

Sequencing Primer
(F):5'- GCAGGCCTAACAAAAATTTCTGTTG -3'
(R):5'- CAAAAGCTAGGCAGATGC -3'
Posted On2017-10-10