Incidental Mutation 'R0526:Akap8'
ID 48956
Institutional Source Beutler Lab
Gene Symbol Akap8
Ensembl Gene ENSMUSG00000024045
Gene Name A kinase (PRKA) anchor protein 8
Synonyms 1200016A02Rik, AKAP95
MMRRC Submission 038719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0526 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 32303676-32321153 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32317292 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 49 (T49I)
Ref Sequence ENSEMBL: ENSMUSP00000002699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002699] [ENSMUST00000050214]
AlphaFold Q9DBR0
Predicted Effect probably benign
Transcript: ENSMUST00000002699
AA Change: T49I

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045
AA Change: T49I

DomainStartEndE-ValueType
SCOP:d1a0tp_ 12 108 3e-19 SMART
low complexity region 183 198 N/A INTRINSIC
low complexity region 257 270 N/A INTRINSIC
low complexity region 354 384 N/A INTRINSIC
ZnF_C2H2 387 411 9.46e0 SMART
Blast:ZnF_C2H2 476 501 9e-9 BLAST
low complexity region 551 582 N/A INTRINSIC
low complexity region 642 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050214
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the A-kinase anchoring protein (AKAP) family. These proteins are characterized by their ability to bind to the R subunit of protein kinase A (PKA) and anchor the protein at different subcellular locations. This protein has been shown to regulate apoptosis and to be involved in palatogenesis. Knockdown of this gene has been associated with altered histone modifications and reduced expression of developmental genes in mouse embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Blm G T 7: 80,505,893 S346* probably null Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Ect2l C A 10: 18,199,940 C66F possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fbxo38 A G 18: 62,505,980 Y1084H probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Fgd3 C T 13: 49,296,524 S83N probably benign Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Megf6 A G 4: 154,258,941 K561R probably benign Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1093 A T 2: 86,786,347 T206S possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Prf1 G A 10: 61,300,254 R103H probably benign Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Akap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Akap8 APN 17 32317280 missense probably damaging 1.00
IGL01450:Akap8 APN 17 32315687 missense probably damaging 1.00
IGL02002:Akap8 APN 17 32309496 missense probably damaging 1.00
IGL02223:Akap8 APN 17 32316647 missense probably damaging 1.00
IGL02315:Akap8 APN 17 32305501 missense probably benign 0.01
IGL03404:Akap8 APN 17 32312276 splice site probably benign
BB006:Akap8 UTSW 17 32309445 missense probably damaging 1.00
BB016:Akap8 UTSW 17 32309445 missense probably damaging 1.00
R0310:Akap8 UTSW 17 32316260 missense possibly damaging 0.81
R1795:Akap8 UTSW 17 32315477 missense probably damaging 1.00
R1992:Akap8 UTSW 17 32316612 missense probably damaging 0.99
R2571:Akap8 UTSW 17 32315455 missense probably damaging 1.00
R2918:Akap8 UTSW 17 32305648 missense probably benign 0.01
R3423:Akap8 UTSW 17 32316455 missense possibly damaging 0.61
R3870:Akap8 UTSW 17 32317839 unclassified probably benign
R4077:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4078:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4379:Akap8 UTSW 17 32306560 missense probably damaging 0.99
R4756:Akap8 UTSW 17 32316210 missense probably damaging 0.98
R4819:Akap8 UTSW 17 32312305 missense probably damaging 1.00
R5091:Akap8 UTSW 17 32316234 missense probably benign 0.05
R5761:Akap8 UTSW 17 32317185 missense possibly damaging 0.56
R6896:Akap8 UTSW 17 32317331 missense probably benign 0.00
R7138:Akap8 UTSW 17 32316541 missense possibly damaging 0.86
R7350:Akap8 UTSW 17 32316575 missense possibly damaging 0.92
R7929:Akap8 UTSW 17 32309445 missense probably damaging 1.00
R8693:Akap8 UTSW 17 32310651 missense probably damaging 1.00
R8810:Akap8 UTSW 17 32306530 missense probably damaging 1.00
R9521:Akap8 UTSW 17 32311062 missense possibly damaging 0.89
X0020:Akap8 UTSW 17 32315750 missense probably benign 0.08
Z1176:Akap8 UTSW 17 32306549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCATAATCACCTGTCTCGGTCC -3'
(R):5'- CGTATCAGAGCTAGGCTGACCTGAAG -3'

Sequencing Primer
(F):5'- ACCGCTGCTGATCCCAC -3'
(R):5'- AGGAAACAAGTCCTTCTGTCTC -3'
Posted On 2013-06-12