Incidental Mutation 'R6156:Zfp64'
ID489565
Institutional Source Beutler Lab
Gene Symbol Zfp64
Ensembl Gene ENSMUSG00000027551
Gene Namezinc finger protein 64
Synonyms
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R6156 (G1)
Quality Score175.009
Status Validated
Chromosome2
Chromosomal Location168893331-168955587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 168926168 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 508 (I508T)
Ref Sequence ENSEMBL: ENSMUSP00000085285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087971] [ENSMUST00000109162]
Predicted Effect probably benign
Transcript: ENSMUST00000087971
AA Change: I508T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085285
Gene: ENSMUSG00000027551
AA Change: I508T

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 308 6.32e-3 SMART
ZnF_C2H2 313 335 2.05e-2 SMART
ZnF_C2H2 341 363 1.95e-3 SMART
ZnF_C2H2 369 392 1.36e-2 SMART
ZnF_C2H2 423 445 1.47e-3 SMART
low complexity region 503 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109162
SMART Domains Protein: ENSMUSP00000104790
Gene: ENSMUSG00000027551

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 297 322 5.2e0 SMART
ZnF_C2H2 328 350 4.17e-3 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.24e-3 SMART
ZnF_C2H2 412 434 1.79e-2 SMART
ZnF_C2H2 440 463 9.58e-3 SMART
ZnF_C2H2 465 487 3.78e-1 SMART
ZnF_C2H2 493 515 3.89e-3 SMART
ZnF_C2H2 521 544 1.92e-2 SMART
ZnF_C2H2 578 600 5.34e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Dock2 C A 11: 34,247,789 V1484F possibly damaging Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gabbr1 T C 17: 37,048,427 I98T probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Mmp11 G A 10: 75,926,491 A336V probably damaging Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr395 A T 11: 73,906,621 Y290* probably null Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Paqr3 A C 5: 97,108,269 L82R probably damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Tnc A G 4: 63,970,352 Y1735H probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Wdhd1 C T 14: 47,268,196 G273D probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Other mutations in Zfp64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Zfp64 APN 2 168926681 missense probably benign 0.06
IGL01479:Zfp64 APN 2 168951679 missense probably damaging 1.00
IGL02320:Zfp64 APN 2 168926198 missense probably damaging 0.98
IGL03411:Zfp64 APN 2 168951542 splice site probably null
PIT4362001:Zfp64 UTSW 2 168925815 missense probably benign 0.23
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0230:Zfp64 UTSW 2 168912230 splice site probably benign
R0325:Zfp64 UTSW 2 168926040 missense probably benign 0.00
R0689:Zfp64 UTSW 2 168935201 splice site probably benign
R1741:Zfp64 UTSW 2 168926318 missense probably benign 0.05
R2054:Zfp64 UTSW 2 168925808 missense probably damaging 1.00
R2133:Zfp64 UTSW 2 168940743 missense probably damaging 1.00
R2254:Zfp64 UTSW 2 168926742 missense probably damaging 0.96
R4093:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4094:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4257:Zfp64 UTSW 2 168926378 missense probably damaging 1.00
R4630:Zfp64 UTSW 2 168926543 missense possibly damaging 0.94
R4642:Zfp64 UTSW 2 168934931 missense probably benign 0.22
R4817:Zfp64 UTSW 2 168926112 missense probably benign
R4880:Zfp64 UTSW 2 168894377 missense probably damaging 1.00
R5051:Zfp64 UTSW 2 168926384 missense probably damaging 0.98
R5155:Zfp64 UTSW 2 168906965 missense probably benign 0.17
R5562:Zfp64 UTSW 2 168925722 missense probably benign 0.00
R5619:Zfp64 UTSW 2 168899814 missense probably damaging 0.99
R5619:Zfp64 UTSW 2 168899815 missense probably damaging 0.97
R5620:Zfp64 UTSW 2 168899968 missense possibly damaging 0.70
R5919:Zfp64 UTSW 2 168926499 missense probably benign 0.05
R6364:Zfp64 UTSW 2 168912266 missense probably damaging 1.00
R6488:Zfp64 UTSW 2 168935209 critical splice donor site probably null
R6512:Zfp64 UTSW 2 168894077 missense probably benign 0.00
R6588:Zfp64 UTSW 2 168926907 missense probably damaging 1.00
R7103:Zfp64 UTSW 2 168926437 missense probably benign 0.00
R7313:Zfp64 UTSW 2 168899890 missense probably damaging 1.00
R7470:Zfp64 UTSW 2 168925811 missense probably damaging 1.00
R7529:Zfp64 UTSW 2 168894072 missense probably benign
R7560:Zfp64 UTSW 2 168925665 missense probably damaging 1.00
R8037:Zfp64 UTSW 2 168900012 missense not run
R8038:Zfp64 UTSW 2 168900012 missense not run
Predicted Primers PCR Primer
(F):5'- AGGACAGTTGGCTGACTCAG -3'
(R):5'- AAGACGTTCCACTGCGACATC -3'

Sequencing Primer
(F):5'- AGTTGGCTGACTCAGGGCAC -3'
(R):5'- ACTGCGACATCTGTGACG -3'
Posted On2017-10-10