Mutagenetix > Incidental Mutation

Incidental Mutation 'R6156:Tbx15'

489566

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

044303-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R6156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 99313115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably null
Transcript: ENSMUST00000029462

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000150756

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	G	15: 64,817,639		probably null	Het
Ank2	T	C	3: 126,944,237	D2579G	probably damaging	Het
Atp6v1b1	G	C	6: 83,758,133	G423R	probably damaging	Het
B4galnt3	T	C	6: 120,214,840	N644S	probably benign	Het
Capsl	T	G	15: 9,465,834	M132R	probably damaging	Het
Cep120	A	G	18: 53,703,223	Y797H	probably benign	Het
Clec2e	T	A	6: 129,095,098	D106V	possibly damaging	Het
Col6a2	C	T	10: 76,604,170	V634I	possibly damaging	Het
Dis3	T	C	14: 99,098,779	E97G	probably benign	Het
Dlec1	T	C	9: 119,110,213		probably null	Het
Dock2	C	A	11: 34,247,789	V1484F	possibly damaging	Het
Ephb2	T	A	4: 136,661,505	M593L	probably benign	Het
Fcgrt	T	C	7: 45,102,060	T125A	probably benign	Het
Gabbr1	T	C	17: 37,048,427	I98T	probably benign	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Gfod1	T	C	13: 43,201,038	S154G	possibly damaging	Het
Ggt5	C	T	10: 75,609,326	T389I	probably damaging	Het
Gm5096	C	A	18: 87,757,107	Y251*	probably null	Het
Got2	A	G	8: 95,872,268	F169L	probably benign	Het
Gse1	A	G	8: 120,489,127	K5E	possibly damaging	Het
Hyal5	T	C	6: 24,891,438	I417T	possibly damaging	Het
Igkv4-91	G	T	6: 68,768,623	T97K	probably damaging	Het
Il4i1	T	C	7: 44,840,184	Y458H	possibly damaging	Het
Impg1	A	T	9: 80,322,824	C740S	probably damaging	Het
Itgb1	C	G	8: 128,732,054	T788R	possibly damaging	Het
Lman2l	A	G	1: 36,438,826	V143A	probably damaging	Het
Ltbp4	G	T	7: 27,330,162	T136K	unknown	Het
Macf1	A	G	4: 123,472,280	I1331T	probably benign	Het
Mmp11	G	A	10: 75,926,491	A336V	probably damaging	Het
Myh2	A	T	11: 67,181,053	I536F	probably damaging	Het
Myh4	A	G	11: 67,250,792	M826V	probably benign	Het
Naca	T	C	10: 128,039,291		probably benign	Het
Nr4a2	A	G	2: 57,112,352	Y30H	probably damaging	Het
Olfr1200	T	A	2: 88,767,590	I242L	probably benign	Het
Olfr1290	A	T	2: 111,489,750	M136K	probably damaging	Het
Olfr1316	A	T	2: 112,130,100	L237Q	probably damaging	Het
Olfr136	T	A	17: 38,335,173	N5K	probably damaging	Het
Olfr1427	A	G	19: 12,099,120	V173A	possibly damaging	Het
Olfr395	A	T	11: 73,906,621	Y290*	probably null	Het
Olfr533	A	G	7: 140,466,845	T215A	probably benign	Het
Olfr936	T	A	9: 39,047,375	M15L	possibly damaging	Het
Paqr3	A	C	5: 97,108,269	L82R	probably damaging	Het
Pex6	C	T	17: 46,720,641	P456S	probably benign	Het
Pih1d2	A	T	9: 50,621,152	K186I	possibly damaging	Het
Plekhh3	A	G	11: 101,170,187		probably benign	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Rcor3	T	A	1: 192,127,842		probably benign	Het
Rgs11	T	A	17: 26,210,465	Y403*	probably null	Het
Scn10a	T	C	9: 119,635,583	N984D	probably benign	Het
Snx14	C	T	9: 88,407,339	A287T	possibly damaging	Het
Stx3	T	C	19: 11,803,510	D33G	probably damaging	Het
Tacc2	A	G	7: 130,625,764	K1393R	probably damaging	Het
Tas2r129	T	C	6: 132,951,492	S131P	probably benign	Het
Tex33	T	C	15: 78,378,813	T214A	probably damaging	Het
Thada	A	G	17: 84,393,367	V1237A	probably damaging	Het
Tnc	A	G	4: 63,970,352	Y1735H	probably damaging	Het
Ttc22	A	G	4: 106,638,583	K378R	probably benign	Het
Tubg2	A	G	11: 101,160,809	K287E	possibly damaging	Het
Ugt3a1	T	C	15: 9,310,676	I348T	possibly damaging	Het
Unc79	A	G	12: 103,061,458	N436S	probably damaging	Het
Unc80	A	T	1: 66,612,250	I1585F	probably benign	Het
Vmn2r104	T	C	17: 20,041,647	Y407C	probably damaging	Het
Vmn2r108	T	A	17: 20,472,185	L136F	probably benign	Het
Vmn2r38	A	G	7: 9,094,612	S161P	probably damaging	Het
Vmn2r90	T	C	17: 17,733,344	I590T	probably benign	Het
Washc5	T	C	15: 59,345,399	E323G	probably damaging	Het
Wdhd1	C	T	14: 47,268,196	G273D	probably damaging	Het
Xpo6	G	T	7: 126,108,844	Q851K	probably damaging	Het
Zfp386	T	C	12: 116,059,906	S380P	probably damaging	Het
Zfp536	A	G	7: 37,473,856	C274R	unknown	Het
Zfp64	A	G	2: 168,926,168	I508T	probably benign	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACACTCTAAGCTCCTACTCG -3'
(R):5'- AGCCACTTAGTATTTGCTCCTGTAG -3'

Sequencing Primer
(F):5'- ACTCTAAGCTCCTACTCGAGTTTAC -3'
(R):5'- ATTTGCTCCTGTAGGGACAC -3'

Posted On

2017-10-10