Mutagenetix > Incidental Mutations

Incidental Mutation 'R6156:Ank2'

489567

Institutional Source

Beutler Lab

Gene Symbol

Ank2

Ensembl Gene

ENSMUSG00000032826

Gene Name

ankyrin 2, brain

Synonyms

Ankyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B

MMRRC Submission

044303-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126921612-127499350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126944237 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2579 (D2579G)

Ref Sequence

ENSEMBL: ENSMUSP00000138753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078]

Predicted Effect

probably benign
Transcript: ENSMUST00000044443

SMART Domains

Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826

Domain	Start	End	E-Value	Type
low complexity region	9	22	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
ZU5	128	232	4.13e-61	SMART
Pfam:ZU5	289	374	2.8e-8	PFAM
low complexity region	587	597	N/A	INTRINSIC
DEATH	603	697	1.52e-27	SMART
low complexity region	732	748	N/A	INTRINSIC
low complexity region	860	873	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182025

Predicted Effect

probably benign
Transcript: ENSMUST00000182062

Predicted Effect

probably damaging
Transcript: ENSMUST00000182064
AA Change: D2666G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: D2666G

Domain	Start	End	E-Value	Type
ANK	9	38	1e1	SMART
ANK	42	71	8.9e-7	SMART
ANK	75	104	4.4e-9	SMART
ANK	108	137	2.8e-9	SMART
ANK	141	169	5.3e-1	SMART
ANK	170	199	7.3e-1	SMART
ANK	211	240	1.1e-7	SMART
ANK	244	273	4.4e-9	SMART
ANK	277	306	9.3e-8	SMART
ANK	310	339	2.1e-8	SMART
ANK	343	372	1.3e-7	SMART
ANK	376	405	6.2e-9	SMART
ANK	409	438	1.1e-7	SMART
ANK	442	471	2.9e-8	SMART
ANK	475	504	1.1e-5	SMART
ANK	508	537	6.5e-6	SMART
ANK	541	570	2.3e-7	SMART
ANK	574	603	2.4e-7	SMART
ANK	607	636	3.2e-9	SMART
ANK	640	669	5.5e-5	SMART
ANK	673	702	1.9e-8	SMART
ANK	706	735	3.3e-9	SMART
low complexity region	755	775	N/A	INTRINSIC
low complexity region	793	806	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
ZU5	912	1016	2e-63	SMART
low complexity region	1371	1381	N/A	INTRINSIC
low complexity region	1448	1463	N/A	INTRINSIC
low complexity region	1490	1503	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182078
AA Change: D2579G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: D2579G

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
low complexity region	114	125	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	304	312	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
low complexity region	527	544	N/A	INTRINSIC
DEATH	591	685	1e-29	SMART
low complexity region	720	736	N/A	INTRINSIC
low complexity region	848	861	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

97% (68/70)

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	G	15: 64,817,639		probably null	Het
Atp6v1b1	G	C	6: 83,758,133	G423R	probably damaging	Het
B4galnt3	T	C	6: 120,214,840	N644S	probably benign	Het
Capsl	T	G	15: 9,465,834	M132R	probably damaging	Het
Cep120	A	G	18: 53,703,223	Y797H	probably benign	Het
Clec2e	T	A	6: 129,095,098	D106V	possibly damaging	Het
Col6a2	C	T	10: 76,604,170	V634I	possibly damaging	Het
Dis3	T	C	14: 99,098,779	E97G	probably benign	Het
Dlec1	T	C	9: 119,110,213		probably null	Het
Dock2	C	A	11: 34,247,789	V1484F	possibly damaging	Het
Ephb2	T	A	4: 136,661,505	M593L	probably benign	Het
Fcgrt	T	C	7: 45,102,060	T125A	probably benign	Het
Gabbr1	T	C	17: 37,048,427	I98T	probably benign	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Gfod1	T	C	13: 43,201,038	S154G	possibly damaging	Het
Ggt5	C	T	10: 75,609,326	T389I	probably damaging	Het
Gm5096	C	A	18: 87,757,107	Y251*	probably null	Het
Got2	A	G	8: 95,872,268	F169L	probably benign	Het
Gse1	A	G	8: 120,489,127	K5E	possibly damaging	Het
Hyal5	T	C	6: 24,891,438	I417T	possibly damaging	Het
Igkv4-91	G	T	6: 68,768,623	T97K	probably damaging	Het
Il4i1	T	C	7: 44,840,184	Y458H	possibly damaging	Het
Impg1	A	T	9: 80,322,824	C740S	probably damaging	Het
Itgb1	C	G	8: 128,732,054	T788R	possibly damaging	Het
Lman2l	A	G	1: 36,438,826	V143A	probably damaging	Het
Ltbp4	G	T	7: 27,330,162	T136K	unknown	Het
Macf1	A	G	4: 123,472,280	I1331T	probably benign	Het
Mmp11	G	A	10: 75,926,491	A336V	probably damaging	Het
Myh2	A	T	11: 67,181,053	I536F	probably damaging	Het
Myh4	A	G	11: 67,250,792	M826V	probably benign	Het
Naca	T	C	10: 128,039,291		probably benign	Het
Nr4a2	A	G	2: 57,112,352	Y30H	probably damaging	Het
Olfr1200	T	A	2: 88,767,590	I242L	probably benign	Het
Olfr1290	A	T	2: 111,489,750	M136K	probably damaging	Het
Olfr1316	A	T	2: 112,130,100	L237Q	probably damaging	Het
Olfr136	T	A	17: 38,335,173	N5K	probably damaging	Het
Olfr1427	A	G	19: 12,099,120	V173A	possibly damaging	Het
Olfr395	A	T	11: 73,906,621	Y290*	probably null	Het
Olfr533	A	G	7: 140,466,845	T215A	probably benign	Het
Olfr936	T	A	9: 39,047,375	M15L	possibly damaging	Het
Paqr3	A	C	5: 97,108,269	L82R	probably damaging	Het
Pex6	C	T	17: 46,720,641	P456S	probably benign	Het
Pih1d2	A	T	9: 50,621,152	K186I	possibly damaging	Het
Plekhh3	A	G	11: 101,170,187		probably benign	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Rcor3	T	A	1: 192,127,842		probably benign	Het
Rgs11	T	A	17: 26,210,465	Y403*	probably null	Het
Scn10a	T	C	9: 119,635,583	N984D	probably benign	Het
Snx14	C	T	9: 88,407,339	A287T	possibly damaging	Het
Stx3	T	C	19: 11,803,510	D33G	probably damaging	Het
Tacc2	A	G	7: 130,625,764	K1393R	probably damaging	Het
Tas2r129	T	C	6: 132,951,492	S131P	probably benign	Het
Tbx15	G	T	3: 99,313,115		probably null	Het
Tex33	T	C	15: 78,378,813	T214A	probably damaging	Het
Thada	A	G	17: 84,393,367	V1237A	probably damaging	Het
Tnc	A	G	4: 63,970,352	Y1735H	probably damaging	Het
Ttc22	A	G	4: 106,638,583	K378R	probably benign	Het
Tubg2	A	G	11: 101,160,809	K287E	possibly damaging	Het
Ugt3a1	T	C	15: 9,310,676	I348T	possibly damaging	Het
Unc79	A	G	12: 103,061,458	N436S	probably damaging	Het
Unc80	A	T	1: 66,612,250	I1585F	probably benign	Het
Vmn2r104	T	C	17: 20,041,647	Y407C	probably damaging	Het
Vmn2r108	T	A	17: 20,472,185	L136F	probably benign	Het
Vmn2r38	A	G	7: 9,094,612	S161P	probably damaging	Het
Vmn2r90	T	C	17: 17,733,344	I590T	probably benign	Het
Washc5	T	C	15: 59,345,399	E323G	probably damaging	Het
Wdhd1	C	T	14: 47,268,196	G273D	probably damaging	Het
Xpo6	G	T	7: 126,108,844	Q851K	probably damaging	Het
Zfp386	T	C	12: 116,059,906	S380P	probably damaging	Het
Zfp536	A	G	7: 37,473,856	C274R	unknown	Het
Zfp64	A	G	2: 168,926,168	I508T	probably benign	Het

Other mutations in Ank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01298:Ank2	APN	3	126959720	missense	possibly damaging	0.80
IGL01652:Ank2	APN	3	126933041	missense	probably benign	0.00
IGL01969:Ank2	APN	3	126953223	missense	possibly damaging	0.47
IGL02122:Ank2	APN	3	126937874	splice site	probably benign
IGL02537:Ank2	APN	3	126955916	missense	probably damaging	1.00
IGL02858:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL02981:Ank2	APN	3	126934562	missense	possibly damaging	0.58
IGL02981:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03024:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03074:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03111:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03129:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03174:Ank2	APN	3	126940095	missense	probably damaging	0.98
IGL03177:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03185:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03188:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03242:Ank2	APN	3	126928805	missense	possibly damaging	0.90
IGL03244:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03248:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03285:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03304:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03358:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03380:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03389:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03400:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03409:Ank2	APN	3	126955870	missense	probably damaging	1.00
ballast	UTSW	3	126943133	missense	unknown
Chain	UTSW	3	126946938	intron	probably benign
drag	UTSW	3	127003982	missense	probably damaging	1.00
mooring	UTSW	3	126934577	missense	possibly damaging	0.73
Windlass	UTSW	3	126946149	missense	probably benign
R0033:Ank2	UTSW	3	127104748	splice site	probably benign
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0079:Ank2	UTSW	3	126934615	missense	probably benign	0.01
R0423:Ank2	UTSW	3	126929860	nonsense	probably null
R0699:Ank2	UTSW	3	126929829	missense	probably benign	0.00
R0724:Ank2	UTSW	3	126962337	missense	probably damaging	1.00
R0990:Ank2	UTSW	3	126934666	missense	possibly damaging	0.64
R1450:Ank2	UTSW	3	126957302	missense	possibly damaging	0.94
R1500:Ank2	UTSW	3	126932982	missense	probably benign
R1702:Ank2	UTSW	3	126955899	missense	probably benign	0.00
R1703:Ank2	UTSW	3	126929766	missense	probably damaging	1.00
R1710:Ank2	UTSW	3	126933060	nonsense	probably null
R1743:Ank2	UTSW	3	126928675	missense	probably damaging	0.99
R1775:Ank2	UTSW	3	126934547	missense	probably benign	0.00
R1852:Ank2	UTSW	3	126997851	critical splice donor site	probably null
R2198:Ank2	UTSW	3	126934577	missense	possibly damaging	0.73
R2892:Ank2	UTSW	3	127248243	splice site	probably null
R2893:Ank2	UTSW	3	127248243	splice site	probably null
R2894:Ank2	UTSW	3	127248243	splice site	probably null
R3148:Ank2	UTSW	3	126933075	missense	probably benign	0.00
R3776:Ank2	UTSW	3	126942262	intron	probably benign
R3784:Ank2	UTSW	3	126953193	missense	probably damaging	1.00
R3856:Ank2	UTSW	3	126929844	missense	probably benign	0.00
R3906:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3907:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3953:Ank2	UTSW	3	126988160	missense	probably damaging	1.00
R3963:Ank2	UTSW	3	126934596	missense	probably benign
R4367:Ank2	UTSW	3	126946149	missense	probably benign
R4414:Ank2	UTSW	3	127225762	critical splice donor site	probably null
R4432:Ank2	UTSW	3	126947806	intron	probably benign
R4433:Ank2	UTSW	3	126947806	intron	probably benign
R4579:Ank2	UTSW	3	126958963	missense	probably damaging	1.00
R4597:Ank2	UTSW	3	126988151	missense	probably damaging	1.00
R4603:Ank2	UTSW	3	127032016	missense	probably benign	0.00
R4729:Ank2	UTSW	3	126976896	nonsense	probably null
R4815:Ank2	UTSW	3	126936761	missense	probably benign
R4826:Ank2	UTSW	3	126956001	missense	probably benign	0.35
R4871:Ank2	UTSW	3	126959795	missense	probably damaging	1.00
R4880:Ank2	UTSW	3	127046826	splice site	probably null
R4915:Ank2	UTSW	3	126942671	intron	probably benign
R4935:Ank2	UTSW	3	126956064	missense	probably damaging	1.00
R4936:Ank2	UTSW	3	126955039	missense	possibly damaging	0.94
R4937:Ank2	UTSW	3	126962401	missense	probably damaging	1.00
R4946:Ank2	UTSW	3	126941940	intron	probably benign
R4963:Ank2	UTSW	3	127032096	missense	probably benign	0.01
R4989:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5023:Ank2	UTSW	3	126941871	intron	probably benign
R5060:Ank2	UTSW	3	126945921	intron	probably benign
R5078:Ank2	UTSW	3	126942353	intron	probably benign
R5086:Ank2	UTSW	3	126947348	intron	probably benign
R5134:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5148:Ank2	UTSW	3	127025636	intron	probably null
R5175:Ank2	UTSW	3	127004024	missense	probably damaging	1.00
R5275:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5295:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5303:Ank2	UTSW	3	126945804	intron	probably benign
R5309:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5312:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5352:Ank2	UTSW	3	127498991	utr 5 prime	probably benign
R5355:Ank2	UTSW	3	126944049	intron	probably benign
R5386:Ank2	UTSW	3	126981933	missense	probably benign	0.01
R5396:Ank2	UTSW	3	126953226	missense	probably damaging	1.00
R5518:Ank2	UTSW	3	126959699	missense	probably damaging	0.98
R5534:Ank2	UTSW	3	126947298	intron	probably benign
R5554:Ank2	UTSW	3	126998973	missense	possibly damaging	0.78
R5582:Ank2	UTSW	3	126946305	intron	probably benign
R5747:Ank2	UTSW	3	126941751	intron	probably benign
R5794:Ank2	UTSW	3	126930020	missense	probably benign	0.00
R5831:Ank2	UTSW	3	127339159	start gained	probably benign
R5925:Ank2	UTSW	3	126932963	missense	probably benign	0.18
R5954:Ank2	UTSW	3	126997861	missense	probably benign	0.34
R5956:Ank2	UTSW	3	126942688	intron	probably benign
R5986:Ank2	UTSW	3	127012686	missense	possibly damaging	0.94
R5992:Ank2	UTSW	3	126959651	critical splice donor site	probably null
R6020:Ank2	UTSW	3	126946821	intron	probably benign
R6027:Ank2	UTSW	3	126997879	missense	possibly damaging	0.92
R6049:Ank2	UTSW	3	126943020	missense	possibly damaging	0.95
R6060:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
R6114:Ank2	UTSW	3	127011051	missense	probably damaging	1.00
R6124:Ank2	UTSW	3	127248151	missense	probably benign	0.31
R6173:Ank2	UTSW	3	127052746	missense	probably damaging	1.00
R6176:Ank2	UTSW	3	126945471	missense	probably benign	0.05
R6184:Ank2	UTSW	3	126962398	missense	probably damaging	1.00
R6199:Ank2	UTSW	3	127004006	missense	probably damaging	1.00
R6241:Ank2	UTSW	3	127052748	missense	probably damaging	1.00
R6254:Ank2	UTSW	3	126941804	intron	probably benign
R6259:Ank2	UTSW	3	127016986	missense	probably benign	0.28
R6260:Ank2	UTSW	3	126943557	missense	probably benign
R6321:Ank2	UTSW	3	126946938	intron	probably benign
R6393:Ank2	UTSW	3	126929757	missense	probably damaging	1.00
R6406:Ank2	UTSW	3	127032225	missense	probably damaging	1.00
R6544:Ank2	UTSW	3	126933222	missense	probably damaging	0.99
R6583:Ank2	UTSW	3	127016964	missense	probably damaging	1.00
R6739:Ank2	UTSW	3	127079994	missense	probably damaging	1.00
R6754:Ank2	UTSW	3	127096839	intron	probably benign
R6786:Ank2	UTSW	3	126958932	missense	probably damaging	0.99
R6798:Ank2	UTSW	3	126944264	intron	probably benign
R6882:Ank2	UTSW	3	126945757	intron	probably benign
R6940:Ank2	UTSW	3	126941972	intron	probably benign
R6949:Ank2	UTSW	3	127010884	missense	probably benign	0.00
R7001:Ank2	UTSW	3	127077581	missense	probably damaging	1.00
R7033:Ank2	UTSW	3	126944850	nonsense	probably null
R7036:Ank2	UTSW	3	126946392	intron	probably benign
R7045:Ank2	UTSW	3	127012744	missense	probably damaging	1.00
R7048:Ank2	UTSW	3	127025618	missense	probably benign	0.03
R7054:Ank2	UTSW	3	126943303	intron	probably benign
R7069:Ank2	UTSW	3	126946298	intron	probably benign
R7091:Ank2	UTSW	3	127023351	missense	probably damaging	0.98
R7107:Ank2	UTSW	3	127003982	missense	probably damaging	1.00
R7175:Ank2	UTSW	3	126946941	missense	unknown
R7191:Ank2	UTSW	3	126946392	missense	unknown
R7272:Ank2	UTSW	3	126943133	missense	unknown
R7381:Ank2	UTSW	3	126936628	missense	possibly damaging	0.46
R7394:Ank2	UTSW	3	126936653	missense	possibly damaging	0.77
R7462:Ank2	UTSW	3	126943034	missense	unknown
R7490:Ank2	UTSW	3	126958889	missense	probably damaging	0.99
R7514:Ank2	UTSW	3	127025603	missense	probably benign	0.06
R7534:Ank2	UTSW	3	126934333	intron	probably null
R7540:Ank2	UTSW	3	126988159	missense	possibly damaging	0.94
R7547:Ank2	UTSW	3	126945203	missense	unknown
R7579:Ank2	UTSW	3	126946398	missense	unknown
R7584:Ank2	UTSW	3	126946128	nonsense	probably null
R7625:Ank2	UTSW	3	127052800	missense	probably damaging	1.00
R7698:Ank2	UTSW	3	127032211	missense	probably benign	0.35
R7716:Ank2	UTSW	3	126943166	missense	unknown
R7718:Ank2	UTSW	3	126965013	missense	possibly damaging	0.88
R7722:Ank2	UTSW	3	127029302	missense	probably benign	0.01
R7738:Ank2	UTSW	3	126947622	missense
RF020:Ank2	UTSW	3	126945476	missense	unknown
Z1088:Ank2	UTSW	3	127029509	missense	possibly damaging	0.45

Predicted Primers

PCR Primer
(F):5'- TGAGTCTGACTGTCTTCCGC -3'
(R):5'- GTTTGATGAACTTGAGCAAGAAGC -3'

Sequencing Primer
(F):5'- CCGCTAAATGTGATTTGCAGTC -3'
(R):5'- AAGATGGGTCCTCCTCAGC -3'

Posted On

2017-10-10