Incidental Mutation 'R6156:Tnc'
ID489568
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Nametenascin C
SynonymsTN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6156 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location63959785-64047015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63970352 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1735 (Y1735H)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]
Predicted Effect probably damaging
Transcript: ENSMUST00000030056
AA Change: Y1735H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: Y1735H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: Y1826H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: Y1826H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107377
AA Change: Y1735H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: Y1735H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Dock2 C A 11: 34,247,789 V1484F possibly damaging Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gabbr1 T C 17: 37,048,427 I98T probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Mmp11 G A 10: 75,926,491 A336V probably damaging Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr395 A T 11: 73,906,621 Y290* probably null Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Paqr3 A C 5: 97,108,269 L82R probably damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Wdhd1 C T 14: 47,268,196 G273D probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Zfp64 A G 2: 168,926,168 I508T probably benign Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64017736 missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63964667 missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63964667 missense probably damaging 1.00
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1903:Tnc UTSW 4 64000062 missense probably benign 0.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2075:Tnc UTSW 4 63995666 missense possibly damaging 0.94
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5049:Tnc UTSW 4 64017986 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5560:Tnc UTSW 4 64008709 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 unclassified probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
R7027:Tnc UTSW 4 63984589 missense probably benign 0.02
R7183:Tnc UTSW 4 64013128 missense probably damaging 1.00
R7204:Tnc UTSW 4 63971155 splice site probably null
R7317:Tnc UTSW 4 63972722 missense probably damaging 0.99
R7323:Tnc UTSW 4 63971232 missense probably damaging 0.96
R7327:Tnc UTSW 4 63964762 splice site probably null
R7382:Tnc UTSW 4 64014043 nonsense probably null
R7399:Tnc UTSW 4 64020657 start gained probably benign
R7479:Tnc UTSW 4 64017628 missense possibly damaging 0.95
R7585:Tnc UTSW 4 64020411 missense probably damaging 1.00
R8004:Tnc UTSW 4 63984657 missense probably benign 0.04
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Z1177:Tnc UTSW 4 63960544 critical splice acceptor site probably null
Z1177:Tnc UTSW 4 64007426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAAGGTCTGGTTCTATATCCAGTC -3'
(R):5'- TGGGATTCTTGTCCAAGGCC -3'

Sequencing Primer
(F):5'- GGTCTGGTTCTATATCCAGTCTCTAC -3'
(R):5'- CTTGTCCAAGGCCATGGTTAATG -3'
Posted On2017-10-10