Incidental Mutation 'R6156:Paqr3'
ID489572
Institutional Source Beutler Lab
Gene Symbol Paqr3
Ensembl Gene ENSMUSG00000055725
Gene Nameprogestin and adipoQ receptor family member III
Synonyms6330415A20Rik, RKTG
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6156 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location97082329-97111596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 97108269 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 82 (L82R)
Ref Sequence ENSEMBL: ENSMUSP00000142871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069453] [ENSMUST00000112968] [ENSMUST00000112969] [ENSMUST00000196078]
Predicted Effect probably damaging
Transcript: ENSMUST00000069453
AA Change: L82R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725
AA Change: L82R

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112968
AA Change: L82R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108592
Gene: ENSMUSG00000055725
AA Change: L82R

DomainStartEndE-ValueType
Pfam:HlyIII 64 171 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112969
AA Change: L82R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725
AA Change: L82R

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132127
Predicted Effect probably damaging
Transcript: ENSMUST00000196078
AA Change: L82R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142871
Gene: ENSMUSG00000055725
AA Change: L82R

DomainStartEndE-ValueType
Pfam:HlyIII 64 179 7e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Targeted deletion of this gene causes faster chemical carcinogen-induced skin cell proliferation, higher epidermal thickness, increased number and size of skin papillomas, shorter tumor latency and delayed tumor regression. Heterozygotes develop tumors earlier and more frequently than control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Dock2 C A 11: 34,247,789 V1484F possibly damaging Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gabbr1 T C 17: 37,048,427 I98T probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Mmp11 G A 10: 75,926,491 A336V probably damaging Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr395 A T 11: 73,906,621 Y290* probably null Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Tnc A G 4: 63,970,352 Y1735H probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Wdhd1 C T 14: 47,268,196 G273D probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Zfp64 A G 2: 168,926,168 I508T probably benign Het
Other mutations in Paqr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Paqr3 APN 5 97095937 missense probably benign
IGL01966:Paqr3 APN 5 97099643 missense probably benign 0.21
IGL02133:Paqr3 APN 5 97095931 missense probably benign
PIT4618001:Paqr3 UTSW 5 97103471 missense possibly damaging 0.82
R1601:Paqr3 UTSW 5 97111389 missense probably benign 0.01
R2864:Paqr3 UTSW 5 97099736 missense possibly damaging 0.65
R3419:Paqr3 UTSW 5 97099700 missense probably damaging 1.00
R3799:Paqr3 UTSW 5 97111316 missense probably damaging 1.00
R4352:Paqr3 UTSW 5 97099596 missense probably benign 0.05
R4368:Paqr3 UTSW 5 97108291 missense probably damaging 1.00
R4515:Paqr3 UTSW 5 97103361 missense possibly damaging 0.72
R4583:Paqr3 UTSW 5 97108210 nonsense probably null
R4647:Paqr3 UTSW 5 97108210 nonsense probably null
R4648:Paqr3 UTSW 5 97108210 nonsense probably null
R4811:Paqr3 UTSW 5 97095983 missense probably benign 0.00
R4855:Paqr3 UTSW 5 97108194 missense possibly damaging 0.83
R5910:Paqr3 UTSW 5 97096028 unclassified probably null
R6053:Paqr3 UTSW 5 97111278 missense probably benign 0.12
R6957:Paqr3 UTSW 5 97108251 missense possibly damaging 0.48
R6974:Paqr3 UTSW 5 97108287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCCTGTGCAAGCATTCC -3'
(R):5'- GGGTTGAACCTAGCTGTCAC -3'

Sequencing Primer
(F):5'- TGTGCAAGCATTCCTGACAAAG -3'
(R):5'- CACTCCCAGGATTATTGCAAATGGG -3'
Posted On2017-10-10