Incidental Mutation 'R6156:Mmp11'
ID489599
Institutional Source Beutler Lab
Gene Symbol Mmp11
Ensembl Gene ENSMUSG00000000901
Gene Namematrix metallopeptidase 11
SynonymsST3, stromelysin 3, Stmy3
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6156 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75923222-75936496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75926491 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 336 (A336V)
Ref Sequence ENSEMBL: ENSMUSP00000112940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000924] [ENSMUST00000000925] [ENSMUST00000120281] [ENSMUST00000121304] [ENSMUST00000132869] [ENSMUST00000140388] [ENSMUST00000219728]
Predicted Effect probably damaging
Transcript: ENSMUST00000000924
AA Change: A336V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000924
Gene: ENSMUSG00000000901
AA Change: A336V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000925
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120281
AA Change: A336V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112940
Gene: ENSMUSG00000000901
AA Change: A336V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121304
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133897
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect probably benign
Transcript: ENSMUST00000152222
SMART Domains Protein: ENSMUSP00000116279
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
Blast:HX 2 26 1e-8 BLAST
HX 29 76 7.63e-11 SMART
HX 78 117 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219728
Meta Mutation Damage Score 0.4577 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of endopeptidases that are involved in remodeling extracellular matrix during, for example, embryonic development and tumor progression. The encoded protein undergoes post-translational proteolytic processing by furin endopeptidase to form an active enzyme. Subcutaneous introduction of cells expressing the encoded protein into nude mice results in increased tumor incidence. Mice lacking the encoded protein exhibit a decreased incidence of chemically-induced tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice exhibit a decreased incidence of DMBA-induced carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Dock2 C A 11: 34,247,789 V1484F possibly damaging Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gabbr1 T C 17: 37,048,427 I98T probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr395 A T 11: 73,906,621 Y290* probably null Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Paqr3 A C 5: 97,108,269 L82R probably damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Tnc A G 4: 63,970,352 Y1735H probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Wdhd1 C T 14: 47,268,196 G273D probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Zfp64 A G 2: 168,926,168 I508T probably benign Het
Other mutations in Mmp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Mmp11 APN 10 75926821 missense probably benign 0.00
IGL01690:Mmp11 APN 10 75926896 missense probably damaging 1.00
IGL01804:Mmp11 APN 10 75928470 missense probably benign
R0285:Mmp11 UTSW 10 75925668 missense probably damaging 1.00
R0491:Mmp11 UTSW 10 75926758 missense probably benign 0.04
R0541:Mmp11 UTSW 10 75926933 missense probably damaging 1.00
R1857:Mmp11 UTSW 10 75928357 missense probably benign 0.01
R2400:Mmp11 UTSW 10 75925510 missense probably benign 0.18
R2442:Mmp11 UTSW 10 75927245 missense probably benign 0.09
R3157:Mmp11 UTSW 10 75927114 unclassified probably benign
R3158:Mmp11 UTSW 10 75927114 unclassified probably benign
R3159:Mmp11 UTSW 10 75927114 unclassified probably benign
R4915:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R4917:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R5137:Mmp11 UTSW 10 75925456 missense probably damaging 1.00
R5848:Mmp11 UTSW 10 75927389 missense probably damaging 1.00
R6313:Mmp11 UTSW 10 75923984 makesense probably null
R6569:Mmp11 UTSW 10 75927382 start gained probably benign
R6753:Mmp11 UTSW 10 75928374 missense probably damaging 1.00
R7027:Mmp11 UTSW 10 75932396 unclassified probably benign
R7146:Mmp11 UTSW 10 75928446 missense probably benign
R7163:Mmp11 UTSW 10 75926576 missense possibly damaging 0.64
R7797:Mmp11 UTSW 10 75923480 missense
Predicted Primers PCR Primer
(F):5'- CGAGACTCTCAGCTATGCCTAAG -3'
(R):5'- TCTTATGGCTCCAGTATGTGC -3'

Sequencing Primer
(F):5'- TCTCAGCTATGCCTAAGGAGCG -3'
(R):5'- ATGGCTCCAGTATGTGCTCTATTCTG -3'
Posted On2017-10-10