Incidental Mutation 'R6156:Olfr395'
ID489605
Institutional Source Beutler Lab
Gene Symbol Olfr395
Ensembl Gene ENSMUSG00000062186
Gene Nameolfactory receptor 395
SynonymsGA_x6K02T2P1NL-4062605-4061667, MOR135-10
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6156 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73903318-73909299 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 73906621 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 290 (Y290*)
Ref Sequence ENSEMBL: ENSMUSP00000149064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072991] [ENSMUST00000215690]
Predicted Effect probably null
Transcript: ENSMUST00000072991
AA Change: Y290*
SMART Domains Protein: ENSMUSP00000072756
Gene: ENSMUSG00000062186
AA Change: Y290*

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Pfam:7tm_4 31 309 6.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.8e-8 PFAM
Pfam:7tm_1 41 290 3.7e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215690
AA Change: Y290*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Dock2 C A 11: 34,247,789 V1484F possibly damaging Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gabbr1 T C 17: 37,048,427 I98T probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Mmp11 G A 10: 75,926,491 A336V probably damaging Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Paqr3 A C 5: 97,108,269 L82R probably damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Tnc A G 4: 63,970,352 Y1735H probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Wdhd1 C T 14: 47,268,196 G273D probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Zfp64 A G 2: 168,926,168 I508T probably benign Het
Other mutations in Olfr395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr395 APN 11 73907313 missense probably damaging 1.00
IGL01618:Olfr395 APN 11 73907477 missense probably damaging 1.00
IGL01995:Olfr395 APN 11 73907435 missense possibly damaging 0.52
IGL02494:Olfr395 APN 11 73906724 missense possibly damaging 0.55
IGL02995:Olfr395 APN 11 73907219 missense possibly damaging 0.90
IGL03256:Olfr395 APN 11 73906696 missense probably benign 0.07
R0018:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R0701:Olfr395 UTSW 11 73906829 missense probably damaging 1.00
R0839:Olfr395 UTSW 11 73907312 missense probably damaging 0.99
R1222:Olfr395 UTSW 11 73907414 missense probably damaging 1.00
R1737:Olfr395 UTSW 11 73907085 missense possibly damaging 0.69
R1819:Olfr395 UTSW 11 73906679 missense probably benign 0.02
R2994:Olfr395 UTSW 11 73906715 missense probably damaging 1.00
R3195:Olfr395 UTSW 11 73906658 missense possibly damaging 0.91
R4622:Olfr395 UTSW 11 73906911 missense possibly damaging 0.55
R4753:Olfr395 UTSW 11 73906851 missense probably damaging 1.00
R5137:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R5448:Olfr395 UTSW 11 73906611 missense probably damaging 1.00
R5604:Olfr395 UTSW 11 73907027 missense probably benign 0.02
R5748:Olfr395 UTSW 11 73906895 missense probably damaging 0.98
R5899:Olfr395 UTSW 11 73906929 missense probably damaging 1.00
R6388:Olfr395 UTSW 11 73907292 missense probably damaging 1.00
R6572:Olfr395 UTSW 11 73906803 missense possibly damaging 0.91
R7241:Olfr395 UTSW 11 73907232 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTTGATTCATGCACCAAGCC -3'
(R):5'- GACATCCACAAGGTCTTCTCTACC -3'

Sequencing Primer
(F):5'- GATTCATGCACCAAGCCTCTTTTTG -3'
(R):5'- ACAAGGTCTTCTCTACCTGTGG -3'
Posted On2017-10-10