Incidental Mutation 'R6156:Wdhd1'
ID489611
Institutional Source Beutler Lab
Gene Symbol Wdhd1
Ensembl Gene ENSMUSG00000037572
Gene NameWD repeat and HMG-box DNA binding protein 1
SynonymsAND-1, D630024B06Rik
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6156 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location47240944-47276857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47268196 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 273 (G273D)
Ref Sequence ENSEMBL: ENSMUSP00000107420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531]
Predicted Effect probably damaging
Transcript: ENSMUST00000111790
AA Change: G273D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572
AA Change: G273D

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 2.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111791
AA Change: G273D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: G273D

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:Mcl1_mid 424 708 1.6e-103 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111792
AA Change: G273D

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: G273D

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 316 326 N/A INTRINSIC
Pfam:DUF3639 488 514 7.1e-13 PFAM
coiled coil region 765 797 N/A INTRINSIC
HMG 966 1036 2.64e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139124
Predicted Effect probably damaging
Transcript: ENSMUST00000187531
AA Change: G273D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: G273D

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 3e-13 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Meta Mutation Damage Score 0.3542 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Dock2 C A 11: 34,247,789 V1484F possibly damaging Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gabbr1 T C 17: 37,048,427 I98T probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Mmp11 G A 10: 75,926,491 A336V probably damaging Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr395 A T 11: 73,906,621 Y290* probably null Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Paqr3 A C 5: 97,108,269 L82R probably damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Tnc A G 4: 63,970,352 Y1735H probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Zfp64 A G 2: 168,926,168 I508T probably benign Het
Other mutations in Wdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Wdhd1 APN 14 47250782 missense possibly damaging 0.87
IGL01789:Wdhd1 APN 14 47274817 missense probably benign 0.10
IGL01981:Wdhd1 APN 14 47261450 missense probably damaging 1.00
IGL02034:Wdhd1 APN 14 47261351 missense probably benign 0.02
IGL02932:Wdhd1 APN 14 47272134 critical splice donor site probably null
IGL02966:Wdhd1 APN 14 47241644 missense possibly damaging 0.93
IGL03355:Wdhd1 APN 14 47243889 missense possibly damaging 0.78
R0165:Wdhd1 UTSW 14 47267068 missense probably benign 0.00
R0414:Wdhd1 UTSW 14 47276588 missense probably benign
R0603:Wdhd1 UTSW 14 47263586 missense probably damaging 1.00
R1503:Wdhd1 UTSW 14 47247400 missense probably benign 0.00
R1539:Wdhd1 UTSW 14 47245050 missense possibly damaging 0.63
R1541:Wdhd1 UTSW 14 47268192 nonsense probably null
R1588:Wdhd1 UTSW 14 47256236 missense probably damaging 1.00
R1686:Wdhd1 UTSW 14 47256215 missense probably damaging 1.00
R1916:Wdhd1 UTSW 14 47258577 missense possibly damaging 0.89
R1952:Wdhd1 UTSW 14 47270190 missense probably damaging 1.00
R2320:Wdhd1 UTSW 14 47274028 missense probably benign 0.06
R2421:Wdhd1 UTSW 14 47258584 missense probably benign 0.00
R3731:Wdhd1 UTSW 14 47247892 missense possibly damaging 0.89
R3818:Wdhd1 UTSW 14 47243801 critical splice donor site probably null
R3836:Wdhd1 UTSW 14 47245054 missense probably benign 0.01
R4789:Wdhd1 UTSW 14 47268692 missense probably benign 0.01
R4963:Wdhd1 UTSW 14 47268689 missense possibly damaging 0.66
R4994:Wdhd1 UTSW 14 47268654 critical splice donor site probably null
R5225:Wdhd1 UTSW 14 47250816 missense probably benign 0.01
R5347:Wdhd1 UTSW 14 47268724 nonsense probably null
R5377:Wdhd1 UTSW 14 47272221 missense probably benign 0.15
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6046:Wdhd1 UTSW 14 47273210 nonsense probably null
R6289:Wdhd1 UTSW 14 47258496 missense possibly damaging 0.95
R6298:Wdhd1 UTSW 14 47273122 missense possibly damaging 0.67
R6345:Wdhd1 UTSW 14 47251922 missense probably damaging 0.99
R6405:Wdhd1 UTSW 14 47243867 missense possibly damaging 0.91
R6500:Wdhd1 UTSW 14 47250760 splice site probably null
R6564:Wdhd1 UTSW 14 47248042 missense probably benign
R6897:Wdhd1 UTSW 14 47248130 missense probably damaging 1.00
R7262:Wdhd1 UTSW 14 47251973 missense probably benign 0.08
R7444:Wdhd1 UTSW 14 47251948 nonsense probably null
R7496:Wdhd1 UTSW 14 47274024 missense probably benign 0.39
R7503:Wdhd1 UTSW 14 47250791 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCAAGCCTCCGTCTAAGTCC -3'
(R):5'- AACCCCAGTATCCTGCAATCTTTG -3'

Sequencing Primer
(F):5'- TCCACGATAACATGTAGTGACCATG -3'
(R):5'- CAATCTTTGCAAGTTGAAATTTCCC -3'
Posted On2017-10-10