Incidental Mutation 'R6156:Gabbr1'
ID489621
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R6156 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37048427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 98 (I98T)
Ref Sequence ENSEMBL: ENSMUSP00000134409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172789] [ENSMUST00000172792] [ENSMUST00000173823] [ENSMUST00000174347] [ENSMUST00000174456]
Predicted Effect probably benign
Transcript: ENSMUST00000025338
AA Change: I98T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: I98T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172789
AA Change: I98T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134580
Gene: ENSMUSG00000024462
AA Change: I98T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172792
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173564
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174347
SMART Domains Protein: ENSMUSP00000134346
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:ANF_receptor 102 213 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174456
AA Change: I98T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134409
Gene: ENSMUSG00000024462
AA Change: I98T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174826
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Dock2 C A 11: 34,247,789 V1484F possibly damaging Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Mmp11 G A 10: 75,926,491 A336V probably damaging Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr395 A T 11: 73,906,621 Y290* probably null Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Paqr3 A C 5: 97,108,269 L82R probably damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Tnc A G 4: 63,970,352 Y1735H probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Wdhd1 C T 14: 47,268,196 G273D probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Zfp64 A G 2: 168,926,168 I508T probably benign Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 intron probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1612:Gabbr1 UTSW 17 37070669 missense probably damaging 1.00
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4299:Gabbr1 UTSW 17 37055900 nonsense probably null
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4510:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5227:Gabbr1 UTSW 17 37070066 missense possibly damaging 0.93
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5485:Gabbr1 UTSW 17 37056875 missense possibly damaging 0.83
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R5976:Gabbr1 UTSW 17 37067862 missense probably damaging 1.00
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6215:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
R7317:Gabbr1 UTSW 17 37069413 missense probably damaging 1.00
R7786:Gabbr1 UTSW 17 37070063 missense probably damaging 0.98
R7793:Gabbr1 UTSW 17 37047501 missense probably benign 0.13
R7833:Gabbr1 UTSW 17 37056969 missense possibly damaging 0.88
R7916:Gabbr1 UTSW 17 37056969 missense possibly damaging 0.88
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGATAGGAATGTGAATACTGGGG -3'
(R):5'- AACCAAGTCTGAGGCAGGTG -3'

Sequencing Primer
(F):5'- AGGATGCTTGTGAACCCA -3'
(R):5'- GTGGTGTAAAGATAGGTTTCACC -3'
Posted On2017-10-10