Incidental Mutation 'R6157:Pag1'
ID489637
Institutional Source Beutler Lab
Gene Symbol Pag1
Ensembl Gene ENSMUSG00000027508
Gene Namephosphoprotein associated with glycosphingolipid microdomains 1
SynonymsF730007C19Rik, Cbp
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6157 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location9687479-9833679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9693836 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 407 (H407Q)
Ref Sequence ENSEMBL: ENSMUSP00000124529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108384] [ENSMUST00000161949]
Predicted Effect probably benign
Transcript: ENSMUST00000108384
AA Change: H407Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104021
Gene: ENSMUSG00000027508
AA Change: H407Q

DomainStartEndE-ValueType
Pfam:PAG 1 429 8.7e-209 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159825
Predicted Effect probably benign
Transcript: ENSMUST00000161949
AA Change: H407Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124529
Gene: ENSMUSG00000027508
AA Change: H407Q

DomainStartEndE-ValueType
Pfam:PAG 2 429 1.4e-208 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type III transmembrane adaptor protein that binds to the tyrosine kinase csk protein. It is thought to be involved in the regulation of T cell activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no apparent defects in embryogenesis, thymic development, or T-cell functions. Mice homozygous for a different knock-out allele show normal T-cell development albeit with an increased thymocyte population. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hltf T A 3: 20,076,496 S293T probably benign Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Mocs1 G T 17: 49,454,736 E619D probably benign Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Olfr640 T A 7: 104,021,898 N140I possibly damaging Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Smpd4 G T 16: 17,641,066 probably null Het
Snx18 T C 13: 113,617,189 S403G probably damaging Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Ufl1 T A 4: 25,279,350 Q83L possibly damaging Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zbtb48 A G 4: 152,021,607 F380L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Pag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Pag1 APN 3 9693826 missense probably damaging 0.97
R0331:Pag1 UTSW 3 9701970 missense probably benign 0.13
R0561:Pag1 UTSW 3 9699421 missense probably damaging 1.00
R1797:Pag1 UTSW 3 9693886 missense probably benign 0.04
R2082:Pag1 UTSW 3 9699485 missense probably damaging 0.96
R2315:Pag1 UTSW 3 9699764 missense probably damaging 1.00
R3772:Pag1 UTSW 3 9699628 missense probably benign 0.20
R4448:Pag1 UTSW 3 9699466 missense probably benign 0.19
R5590:Pag1 UTSW 3 9699422 missense probably damaging 1.00
R6481:Pag1 UTSW 3 9699336 missense possibly damaging 0.85
R6776:Pag1 UTSW 3 9699788 missense probably benign 0.29
R7450:Pag1 UTSW 3 9699539 missense probably damaging 1.00
R7574:Pag1 UTSW 3 9693891 missense probably damaging 1.00
R8046:Pag1 UTSW 3 9699422 missense probably damaging 1.00
R8396:Pag1 UTSW 3 9694052 missense probably benign 0.04
Z1177:Pag1 UTSW 3 9696138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGAGACTGCACTTGAAG -3'
(R):5'- GTATGAAAGGGCCAGAATCTGC -3'

Sequencing Primer
(F):5'- GGAGACTGCACTTGAAGATTTCAGTC -3'
(R):5'- AGAGGTCGTCATCTTCCTGCAATG -3'
Posted On2017-10-10