Incidental Mutation 'R6157:Hltf'
ID489638
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Namehelicase-like transcription factor
SynonymsP113, Snf2l3, Smarca3
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6157 (G1)
Quality Score215.009
Status Validated
Chromosome3
Chromosomal Location20057811-20118490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20076496 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 293 (S293T)
Ref Sequence ENSEMBL: ENSMUSP00000118775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
Predicted Effect probably benign
Transcript: ENSMUST00000002502
AA Change: S355T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: S355T

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably benign
Transcript: ENSMUST00000143005
AA Change: S355T

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428
AA Change: S355T

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
AA Change: S293T

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428
AA Change: S293T

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Mocs1 G T 17: 49,454,736 E619D probably benign Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Olfr640 T A 7: 104,021,898 N140I possibly damaging Het
Pag1 A T 3: 9,693,836 H407Q probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Smpd4 G T 16: 17,641,066 probably null Het
Snx18 T C 13: 113,617,189 S403G probably damaging Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Ufl1 T A 4: 25,279,350 Q83L possibly damaging Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zbtb48 A G 4: 152,021,607 F380L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20105632 splice site probably benign
IGL01461:Hltf APN 3 20099939 nonsense probably null
IGL01630:Hltf APN 3 20082904 splice site probably benign
IGL01704:Hltf APN 3 20083746 splice site probably benign
IGL02059:Hltf APN 3 20106457 missense probably benign
IGL02105:Hltf APN 3 20092757 missense probably damaging 1.00
IGL02156:Hltf APN 3 20092807 missense possibly damaging 0.61
IGL02870:Hltf APN 3 20099873 missense probably damaging 0.98
IGL02899:Hltf APN 3 20099817 missense probably damaging 1.00
IGL02935:Hltf APN 3 20069051 missense probably damaging 1.00
IGL02950:Hltf APN 3 20076572 missense probably benign 0.07
IGL03082:Hltf APN 3 20064559 splice site probably benign
snarky UTSW 3 20109487 critical splice donor site probably null
R0068:Hltf UTSW 3 20059090 missense probably damaging 1.00
R0787:Hltf UTSW 3 20106446 missense probably damaging 1.00
R0905:Hltf UTSW 3 20108869 critical splice donor site probably null
R0980:Hltf UTSW 3 20091501 missense probably benign 0.00
R1741:Hltf UTSW 3 20086188 missense probably damaging 1.00
R1748:Hltf UTSW 3 20076521 missense probably benign 0.13
R1799:Hltf UTSW 3 20105691 missense probably damaging 1.00
R1976:Hltf UTSW 3 20106446 missense probably damaging 1.00
R2171:Hltf UTSW 3 20059081 missense probably damaging 1.00
R2395:Hltf UTSW 3 20092742 missense probably benign 0.41
R2444:Hltf UTSW 3 20063907 missense possibly damaging 0.66
R3789:Hltf UTSW 3 20069047 missense probably damaging 1.00
R3943:Hltf UTSW 3 20092744 missense probably damaging 1.00
R4719:Hltf UTSW 3 20064701 critical splice donor site probably null
R4793:Hltf UTSW 3 20063950 missense possibly damaging 0.79
R5296:Hltf UTSW 3 20108112 missense probably damaging 0.99
R5449:Hltf UTSW 3 20069083 missense possibly damaging 0.92
R5492:Hltf UTSW 3 20098067 splice site probably null
R6012:Hltf UTSW 3 20058934 missense probably damaging 1.00
R6254:Hltf UTSW 3 20063829 missense possibly damaging 0.85
R6553:Hltf UTSW 3 20072394 missense probably damaging 0.96
R6616:Hltf UTSW 3 20109487 critical splice donor site probably null
R6696:Hltf UTSW 3 20065306 intron probably null
R6761:Hltf UTSW 3 20083832 critical splice donor site probably null
R6781:Hltf UTSW 3 20098166 missense probably benign 0.00
R7241:Hltf UTSW 3 20065392 missense probably benign 0.07
R7356:Hltf UTSW 3 20109370 missense probably damaging 1.00
R7453:Hltf UTSW 3 20082752 missense possibly damaging 0.81
R7765:Hltf UTSW 3 20091483 missense probably benign 0.02
X0027:Hltf UTSW 3 20067389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCTCTAGGTTGGCCAATG -3'
(R):5'- GTGATTTAGCAACTGCAGTTAGGAATG -3'

Sequencing Primer
(F):5'- TGGGATTTGAACTCCAGACC -3'
(R):5'- GCAACTGCAGTTAGGAATGTATTTAC -3'
Posted On2017-10-10