Incidental Mutation 'R6157:Ufl1'
ID489639
Institutional Source Beutler Lab
Gene Symbol Ufl1
Ensembl Gene ENSMUSG00000040359
Gene NameUFM1 specific ligase 1
Synonyms1810074P20Rik, Maxer, Rcad
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R6157 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location25248600-25281821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25279350 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 83 (Q83L)
Ref Sequence ENSEMBL: ENSMUSP00000100059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038705] [ENSMUST00000102994]
Predicted Effect probably benign
Transcript: ENSMUST00000038705
SMART Domains Protein: ENSMUSP00000042118
Gene: ENSMUSG00000040359

DomainStartEndE-ValueType
Pfam:DUF2042 2 205 1.5e-70 PFAM
low complexity region 334 344 N/A INTRINSIC
low complexity region 348 358 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102994
AA Change: Q83L

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100059
Gene: ENSMUSG00000040359
AA Change: Q83L

DomainStartEndE-ValueType
Pfam:DUF2042 7 284 4.8e-117 PFAM
low complexity region 414 424 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 444 454 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142949
Meta Mutation Damage Score 0.4518 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogensis, anemia and decreased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hltf T A 3: 20,076,496 S293T probably benign Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Mocs1 G T 17: 49,454,736 E619D probably benign Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Olfr640 T A 7: 104,021,898 N140I possibly damaging Het
Pag1 A T 3: 9,693,836 H407Q probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Smpd4 G T 16: 17,641,066 probably null Het
Snx18 T C 13: 113,617,189 S403G probably damaging Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zbtb48 A G 4: 152,021,607 F380L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Ufl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ufl1 APN 4 25280631 missense possibly damaging 0.67
IGL00899:Ufl1 APN 4 25262238 missense probably damaging 1.00
IGL00928:Ufl1 APN 4 25267790 missense probably damaging 1.00
IGL00949:Ufl1 APN 4 25275822 missense probably damaging 0.99
IGL02179:Ufl1 APN 4 25254896 missense probably damaging 0.99
IGL02228:Ufl1 APN 4 25281686 missense probably benign
IGL02237:Ufl1 APN 4 25269082 missense probably benign 0.01
IGL02294:Ufl1 APN 4 25259281 nonsense probably null
IGL02331:Ufl1 APN 4 25251971 missense probably damaging 1.00
IGL02374:Ufl1 APN 4 25259237 missense probably benign 0.01
IGL02541:Ufl1 APN 4 25250534 missense possibly damaging 0.56
IGL03053:Ufl1 APN 4 25275833 missense probably damaging 0.99
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0172:Ufl1 UTSW 4 25280685 missense probably benign 0.32
R2069:Ufl1 UTSW 4 25269036 missense possibly damaging 0.75
R4320:Ufl1 UTSW 4 25278601 splice site probably null
R4467:Ufl1 UTSW 4 25254806 missense probably damaging 1.00
R4993:Ufl1 UTSW 4 25267832 missense possibly damaging 0.70
R5049:Ufl1 UTSW 4 25254773 missense probably benign 0.17
R5071:Ufl1 UTSW 4 25254780 missense probably benign
R5072:Ufl1 UTSW 4 25254780 missense probably benign
R5073:Ufl1 UTSW 4 25254780 missense probably benign
R5099:Ufl1 UTSW 4 25275914 missense probably damaging 0.99
R5108:Ufl1 UTSW 4 25269026 critical splice donor site probably null
R5127:Ufl1 UTSW 4 25256010 missense probably benign 0.05
R5262:Ufl1 UTSW 4 25251294 intron probably benign
R5409:Ufl1 UTSW 4 25280706 missense probably damaging 1.00
R5942:Ufl1 UTSW 4 25250619 missense probably benign
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6107:Ufl1 UTSW 4 25251999 missense possibly damaging 0.88
R6296:Ufl1 UTSW 4 25270572 missense probably benign
R6360:Ufl1 UTSW 4 25265476 missense probably benign
R6514:Ufl1 UTSW 4 25262238 missense probably damaging 1.00
R6754:Ufl1 UTSW 4 25267796 nonsense probably null
R6755:Ufl1 UTSW 4 25262316 missense probably damaging 0.96
R7196:Ufl1 UTSW 4 25250669 missense probably benign 0.05
R7247:Ufl1 UTSW 4 25254637 missense probably damaging 1.00
R7287:Ufl1 UTSW 4 25254852 missense probably benign 0.04
R7755:Ufl1 UTSW 4 25262274 missense probably benign
R8156:Ufl1 UTSW 4 25269057 missense probably damaging 1.00
R8235:Ufl1 UTSW 4 25278656 missense probably benign 0.31
R8247:Ufl1 UTSW 4 25250606 missense probably benign
RF037:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
RF039:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
V7732:Ufl1 UTSW 4 25251368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATAGCTGAGTATCATGGCAG -3'
(R):5'- AGCGAGTAATCTGTATCTAAGTCC -3'

Sequencing Primer
(F):5'- GAAAAGAGTTTCCGCCTGTC -3'
(R):5'- GTTCATCTGCACGTCCAT -3'
Posted On2017-10-10