Incidental Mutation 'R6157:Zbtb48'
ID489642
Institutional Source Beutler Lab
Gene Symbol Zbtb48
Ensembl Gene ENSMUSG00000028952
Gene Namezinc finger and BTB domain containing 48
Synonyms0610011D15Rik, Hkr3
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6157 (G1)
Quality Score103.008
Status Validated
Chromosome4
Chromosomal Location152019774-152027671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152021607 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 380 (F380L)
Ref Sequence ENSEMBL: ENSMUSP00000114726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066715] [ENSMUST00000097773] [ENSMUST00000131935] [ENSMUST00000155389] [ENSMUST00000156748]
Predicted Effect probably damaging
Transcript: ENSMUST00000066715
AA Change: F380L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952
AA Change: F380L

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097773
SMART Domains Protein: ENSMUSP00000095380
Gene: ENSMUSG00000073700

DomainStartEndE-ValueType
BTB 35 133 2.4e-27 SMART
BACK 138 239 3.93e-27 SMART
Kelch 287 334 1.08e0 SMART
Kelch 336 382 1.3e-7 SMART
Kelch 383 422 5.88e-1 SMART
Kelch 464 512 2.97e-1 SMART
Kelch 513 560 6.57e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123696
Predicted Effect probably benign
Transcript: ENSMUST00000131935
SMART Domains Protein: ENSMUSP00000116423
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147895
Predicted Effect probably damaging
Transcript: ENSMUST00000155389
AA Change: F380L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952
AA Change: F380L

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155441
Predicted Effect probably benign
Transcript: ENSMUST00000156748
SMART Domains Protein: ENSMUSP00000117079
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
ZnF_C2H2 80 102 1.64e-1 SMART
ZnF_C2H2 108 128 2.06e1 SMART
Meta Mutation Damage Score 0.4963 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hltf T A 3: 20,076,496 S293T probably benign Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Mocs1 G T 17: 49,454,736 E619D probably benign Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Olfr640 T A 7: 104,021,898 N140I possibly damaging Het
Pag1 A T 3: 9,693,836 H407Q probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Smpd4 G T 16: 17,641,066 probably null Het
Snx18 T C 13: 113,617,189 S403G probably damaging Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Ufl1 T A 4: 25,279,350 Q83L possibly damaging Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Zbtb48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zbtb48 APN 4 152021394 missense probably damaging 0.99
IGL02709:Zbtb48 APN 4 152021394 missense probably damaging 0.99
Etna UTSW 4 152021607 missense probably damaging 0.98
I0000:Zbtb48 UTSW 4 152019858 missense probably benign 0.34
R1515:Zbtb48 UTSW 4 152020201 unclassified probably null
R1844:Zbtb48 UTSW 4 152026498 missense probably benign
R2383:Zbtb48 UTSW 4 152026950 missense probably damaging 0.96
R3618:Zbtb48 UTSW 4 152026027 splice site probably null
R3619:Zbtb48 UTSW 4 152026027 splice site probably null
R5427:Zbtb48 UTSW 4 152020651 missense probably damaging 1.00
R5696:Zbtb48 UTSW 4 152020610 missense probably damaging 0.99
R6155:Zbtb48 UTSW 4 152022038 unclassified probably null
R6551:Zbtb48 UTSW 4 152022221 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAAAAGCCTCGTGCAGCTG -3'
(R):5'- TAGTATGGCTGGCTGAATATCG -3'

Sequencing Primer
(F):5'- TGTAGCTCCGTCCTAGACAG -3'
(R):5'- TGGCTGAATATCGCCCCC -3'
Posted On2017-10-10