Incidental Mutation 'R6157:Snx18'
ID489660
Institutional Source Beutler Lab
Gene Symbol Snx18
Ensembl Gene ENSMUSG00000042364
Gene Namesorting nexin 18
SynonymsSnag1
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R6157 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location113592179-113618564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113617189 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 403 (S403G)
Ref Sequence ENSEMBL: ENSMUSP00000104864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109241]
Predicted Effect probably damaging
Transcript: ENSMUST00000109241
AA Change: S403G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104864
Gene: ENSMUSG00000042364
AA Change: S403G

DomainStartEndE-ValueType
SH3 3 60 1.04e-14 SMART
low complexity region 61 76 N/A INTRINSIC
low complexity region 82 105 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
PX 264 373 8.75e-22 SMART
Pfam:BAR_3_WASP_bdg 377 613 7.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224883
Meta Mutation Damage Score 0.4762 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a SH3 domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hltf T A 3: 20,076,496 S293T probably benign Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Mocs1 G T 17: 49,454,736 E619D probably benign Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Olfr640 T A 7: 104,021,898 N140I possibly damaging Het
Pag1 A T 3: 9,693,836 H407Q probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Smpd4 G T 16: 17,641,066 probably null Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Ufl1 T A 4: 25,279,350 Q83L possibly damaging Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zbtb48 A G 4: 152,021,607 F380L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Snx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Snx18 APN 13 113617516 missense probably benign 0.13
IGL02068:Snx18 APN 13 113617065 missense probably damaging 1.00
IGL02195:Snx18 APN 13 113616840 missense probably damaging 0.99
IGL02541:Snx18 APN 13 113594766 missense probably damaging 0.98
R2419:Snx18 UTSW 13 113617219 missense possibly damaging 0.52
R2958:Snx18 UTSW 13 113616886 nonsense probably null
R3010:Snx18 UTSW 13 113616886 nonsense probably null
R3011:Snx18 UTSW 13 113616886 nonsense probably null
R4461:Snx18 UTSW 13 113617195 missense probably damaging 1.00
R4557:Snx18 UTSW 13 113617828 missense probably damaging 1.00
R4732:Snx18 UTSW 13 113617774 missense probably benign 0.04
R4733:Snx18 UTSW 13 113617774 missense probably benign 0.04
R5308:Snx18 UTSW 13 113616847 nonsense probably null
R6995:Snx18 UTSW 13 113594729 missense probably damaging 0.99
Z1177:Snx18 UTSW 13 113618145 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATCCAGCTCAAAGGCTTGGC -3'
(R):5'- CATCTCCAAACGCAGGAAGG -3'

Sequencing Primer
(F):5'- TCAAAGGCTTGGCTGAGACC -3'
(R):5'- CGCAGGAAGGGTCTGATCTG -3'
Posted On2017-10-10