Incidental Mutation 'R6157:Mocs1'
ID489666
Institutional Source Beutler Lab
Gene Symbol Mocs1
Ensembl Gene ENSMUSG00000064120
Gene Namemolybdenum cofactor synthesis 1
Synonyms3110045D15Rik
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6157 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location49428362-49455435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49454736 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 619 (E619D)
Ref Sequence ENSEMBL: ENSMUSP00000133694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024797] [ENSMUST00000057610] [ENSMUST00000173033] [ENSMUST00000173362] [ENSMUST00000174647]
Predicted Effect probably benign
Transcript: ENSMUST00000024797
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057610
SMART Domains Protein: ENSMUSP00000052085
Gene: ENSMUSG00000040260

DomainStartEndE-ValueType
Drf_GBD 40 228 4.89e-61 SMART
Drf_FH3 231 429 1.19e-73 SMART
Blast:FH2 476 513 4e-10 BLAST
low complexity region 514 534 N/A INTRINSIC
low complexity region 539 576 N/A INTRINSIC
FH2 595 1085 7.36e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172871
SMART Domains Protein: ENSMUSP00000134449
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Mob_synth_C 1 86 8.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173033
AA Change: E619D

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133694
Gene: ENSMUSG00000064120
AA Change: E619D

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Pfam:MoaC 493 628 6.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173362
SMART Domains Protein: ENSMUSP00000134265
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Fer4_12 67 197 5.8e-11 PFAM
Pfam:Radical_SAM 74 199 2.5e-22 PFAM
Pfam:Fer4_14 75 180 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173430
Predicted Effect probably benign
Transcript: ENSMUST00000174647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224954
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation lack the cofactor molybdopterin and enzyme activities dependent on the cofactor (including sulfate oxidase and xanthine oxidase), have curly whiskers, and die between postnatal days 1 and 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hltf T A 3: 20,076,496 S293T probably benign Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Olfr640 T A 7: 104,021,898 N140I possibly damaging Het
Pag1 A T 3: 9,693,836 H407Q probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Smpd4 G T 16: 17,641,066 probably null Het
Snx18 T C 13: 113,617,189 S403G probably damaging Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Ufl1 T A 4: 25,279,350 Q83L possibly damaging Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zbtb48 A G 4: 152,021,607 F380L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Mocs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mocs1 APN 17 49435264 critical splice donor site probably null
IGL00473:Mocs1 APN 17 49433201 missense probably benign 0.01
IGL01565:Mocs1 APN 17 49452320 missense probably benign 0.00
IGL02822:Mocs1 APN 17 49439569 missense probably damaging 1.00
R0321:Mocs1 UTSW 17 49433258 missense probably damaging 1.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R2155:Mocs1 UTSW 17 49454358 missense probably damaging 1.00
R2271:Mocs1 UTSW 17 49449109 missense probably damaging 1.00
R2398:Mocs1 UTSW 17 49452834 missense probably damaging 0.99
R4669:Mocs1 UTSW 17 49454585 missense possibly damaging 0.67
R5566:Mocs1 UTSW 17 49454183 missense possibly damaging 0.92
R5751:Mocs1 UTSW 17 49449738 unclassified probably null
R6061:Mocs1 UTSW 17 49450313 missense probably damaging 1.00
R6212:Mocs1 UTSW 17 49435196 missense probably damaging 1.00
R6268:Mocs1 UTSW 17 49435155 missense probably damaging 1.00
R7047:Mocs1 UTSW 17 49452859 critical splice donor site probably null
R7270:Mocs1 UTSW 17 49449115 missense possibly damaging 0.83
R7395:Mocs1 UTSW 17 49454557 missense possibly damaging 0.56
R7522:Mocs1 UTSW 17 49435264 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAACCAGTCAGTTGATCCCC -3'
(R):5'- CCTCACAGGTTAGTGGTAAAGAG -3'

Sequencing Primer
(F):5'- TGAGCCACGTGCAGGTACAC -3'
(R):5'- GACAGGGTGATCCTAGGTCTAATCAC -3'
Posted On2017-10-10