Mutagenetix > Incidental Mutation

Incidental Mutation 'R6158:Rgsl1'

489672

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

044305-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6158 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153804021 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 103 (D103G)

Ref Sequence

ENSEMBL: ENSMUSP00000139215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000141249] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

probably benign
Transcript: ENSMUST00000124558
AA Change: D783G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: D783G

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134030

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141249
AA Change: D103G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641
AA Change: D103G

Domain	Start	End	E-Value	Type
Blast:RGS	3	300	3e-30	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

probably benign
Transcript: ENSMUST00000185164
AA Change: D818G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: D818G

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206321

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.5%
20x: 92.6%

Validation Efficiency

98% (65/66)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,170,636	V793A	possibly damaging	Het
2900092C05Rik	A	G	7: 12,512,672	T32A	probably benign	Het
Adprhl1	C	T	8: 13,224,977	V594M	possibly damaging	Het
Ano3	A	T	2: 110,665,875	Y845N	probably damaging	Het
Arhgap24	A	T	5: 102,892,912	I575L	probably benign	Het
Aurka	A	C	2: 172,363,596		probably null	Het
C1qtnf5	A	T	9: 44,108,970		probably benign	Het
Cacnb2	A	G	2: 14,985,601	D454G	possibly damaging	Het
Ccdc58	T	A	16: 36,089,929	V118D	probably damaging	Het
Chchd5	T	C	2: 129,130,517	L87P	probably damaging	Het
Col7a1	G	T	9: 108,964,603	R1377L	unknown	Het
Cpne8	A	C	15: 90,571,988	S191A	probably damaging	Het
Dhx30	A	T	9: 110,087,030	I671N	probably damaging	Het
Dnah12	A	T	14: 26,773,685	K1423N	possibly damaging	Het
Dnm3	T	C	1: 162,320,987	M272V	probably damaging	Het
Fat4	A	T	3: 38,983,262	S3688C	possibly damaging	Het
Frmpd1	A	T	4: 45,285,401	L1407F	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Gm11565	T	A	11: 99,914,918	C45*	probably null	Het
Gngt1	A	T	6: 3,994,311	R30*	probably null	Het
Htt	T	C	5: 34,907,086	I2943T	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lmo7	T	A	14: 101,900,137	D247E	probably benign	Het
Mastl	G	T	2: 23,132,772	N646K	possibly damaging	Het
Mei4	G	T	9: 81,927,576	L237F	probably damaging	Het
Mettl27	C	T	5: 134,940,576	P170S	possibly damaging	Het
Mgam	T	A	6: 40,757,714	I896K	probably damaging	Het
Moxd1	T	A	10: 24,284,777	C443S	probably damaging	Het
Myo18b	A	T	5: 112,874,172	N451K	probably benign	Het
Myo7b	T	C	18: 31,988,549	I768V	probably benign	Het
Nos1	A	C	5: 117,867,574	I120L	probably benign	Het
Nsd1	T	C	13: 55,245,621	V345A	probably benign	Het
Olfr1095	A	G	2: 86,851,515	L61P	possibly damaging	Het
Olfr1205	T	C	2: 88,831,146	F10L	probably damaging	Het
Olfr150	C	T	9: 39,737,076	T87I	probably benign	Het
Olfr170	C	A	16: 19,605,925	V248F	probably damaging	Het
Olfr344	A	T	2: 36,569,116	T173S	probably benign	Het
Pdzph1	T	G	17: 58,973,627	Q553H	probably damaging	Het
Piwil1	T	A	5: 128,747,876	L546*	probably null	Het
Pla2g4f	T	C	2: 120,301,071	T724A	probably benign	Het
Ralgapa2	A	T	2: 146,424,676	M660K	possibly damaging	Het
Rnf186	A	G	4: 138,967,254	D35G	probably damaging	Het
Rock2	A	G	12: 16,954,918	D424G	probably benign	Het
Scg2	A	T	1: 79,435,400	D495E	probably damaging	Het
Slc39a2	G	A	14: 51,894,224		probably null	Het
Snrnp48	T	A	13: 38,210,236	Y100*	probably null	Het
Spaca1	A	G	4: 34,029,176	M99T	probably damaging	Het
Specc1	T	G	11: 62,118,124	F235L	probably damaging	Het
St13	A	T	15: 81,399,601		probably null	Het
Swap70	T	A	7: 110,270,023	M341K	probably damaging	Het
Synj2	A	G	17: 5,986,212	D67G	probably benign	Het
Tmem135	T	A	7: 89,156,444	I251F	probably benign	Het
Tmem87a	A	T	2: 120,360,103		probably null	Het
Tom1l2	C	T	11: 60,232,927	D128N	probably damaging	Het
Tpx2	C	A	2: 152,873,104	H82N	probably benign	Het
Trip12	A	T	1: 84,761,012	C738S	possibly damaging	Het
Ttyh1	A	G	7: 4,125,562	T153A	probably benign	Het
Utrn	C	T	10: 12,690,822	G1199S	probably benign	Het
Vmn1r8	T	A	6: 57,036,289	N108K	probably benign	Het
Vmn2r63	T	A	7: 42,933,680	D37V	probably damaging	Het
Vwce	C	T	19: 10,644,221	R206C	possibly damaging	Het
Wrn	G	T	8: 33,319,172	F265L	probably damaging	Het
Zfp472	T	A	17: 32,978,389	C479*	probably null	Het
Zfp831	A	T	2: 174,643,858	T109S	possibly damaging	Het
Znfx1	G	T	2: 167,056,726	Q93K	probably benign	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- CCGGAGATCTTGTGCCTTTC -3'
(R):5'- AGGCCTTGTTATGTTTCATGCAC -3'

Sequencing Primer
(F):5'- GGACTTCCCAGTACGTTTCTCTGAG -3'
(R):5'- ATGTTTCATGCACCGTGGTTTTATC -3'

Posted On

2017-10-10