Incidental Mutation 'R6158:Ano3'
ID 489679
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission 044305-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6158 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110665875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 845 (Y845N)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: Y845N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: Y845N

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Meta Mutation Damage Score 0.5643 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.5%
  • 20x: 92.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,170,636 V793A possibly damaging Het
2900092C05Rik A G 7: 12,512,672 T32A probably benign Het
Adprhl1 C T 8: 13,224,977 V594M possibly damaging Het
Arhgap24 A T 5: 102,892,912 I575L probably benign Het
Aurka A C 2: 172,363,596 probably null Het
C1qtnf5 A T 9: 44,108,970 probably benign Het
Cacnb2 A G 2: 14,985,601 D454G possibly damaging Het
Ccdc58 T A 16: 36,089,929 V118D probably damaging Het
Chchd5 T C 2: 129,130,517 L87P probably damaging Het
Col7a1 G T 9: 108,964,603 R1377L unknown Het
Cpne8 A C 15: 90,571,988 S191A probably damaging Het
Dhx30 A T 9: 110,087,030 I671N probably damaging Het
Dnah12 A T 14: 26,773,685 K1423N possibly damaging Het
Dnm3 T C 1: 162,320,987 M272V probably damaging Het
Fat4 A T 3: 38,983,262 S3688C possibly damaging Het
Frmpd1 A T 4: 45,285,401 L1407F probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Gm11565 T A 11: 99,914,918 C45* probably null Het
Gngt1 A T 6: 3,994,311 R30* probably null Het
Htt T C 5: 34,907,086 I2943T possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lmo7 T A 14: 101,900,137 D247E probably benign Het
Mastl G T 2: 23,132,772 N646K possibly damaging Het
Mei4 G T 9: 81,927,576 L237F probably damaging Het
Mettl27 C T 5: 134,940,576 P170S possibly damaging Het
Mgam T A 6: 40,757,714 I896K probably damaging Het
Moxd1 T A 10: 24,284,777 C443S probably damaging Het
Myo18b A T 5: 112,874,172 N451K probably benign Het
Myo7b T C 18: 31,988,549 I768V probably benign Het
Nos1 A C 5: 117,867,574 I120L probably benign Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1095 A G 2: 86,851,515 L61P possibly damaging Het
Olfr1205 T C 2: 88,831,146 F10L probably damaging Het
Olfr150 C T 9: 39,737,076 T87I probably benign Het
Olfr170 C A 16: 19,605,925 V248F probably damaging Het
Olfr344 A T 2: 36,569,116 T173S probably benign Het
Pdzph1 T G 17: 58,973,627 Q553H probably damaging Het
Piwil1 T A 5: 128,747,876 L546* probably null Het
Pla2g4f T C 2: 120,301,071 T724A probably benign Het
Ralgapa2 A T 2: 146,424,676 M660K possibly damaging Het
Rgsl1 T C 1: 153,804,021 D103G possibly damaging Het
Rnf186 A G 4: 138,967,254 D35G probably damaging Het
Rock2 A G 12: 16,954,918 D424G probably benign Het
Scg2 A T 1: 79,435,400 D495E probably damaging Het
Slc39a2 G A 14: 51,894,224 probably null Het
Snrnp48 T A 13: 38,210,236 Y100* probably null Het
Spaca1 A G 4: 34,029,176 M99T probably damaging Het
Specc1 T G 11: 62,118,124 F235L probably damaging Het
St13 A T 15: 81,399,601 probably null Het
Swap70 T A 7: 110,270,023 M341K probably damaging Het
Synj2 A G 17: 5,986,212 D67G probably benign Het
Tmem135 T A 7: 89,156,444 I251F probably benign Het
Tmem87a A T 2: 120,360,103 probably null Het
Tom1l2 C T 11: 60,232,927 D128N probably damaging Het
Tpx2 C A 2: 152,873,104 H82N probably benign Het
Trip12 A T 1: 84,761,012 C738S possibly damaging Het
Ttyh1 A G 7: 4,125,562 T153A probably benign Het
Utrn C T 10: 12,690,822 G1199S probably benign Het
Vmn1r8 T A 6: 57,036,289 N108K probably benign Het
Vmn2r63 T A 7: 42,933,680 D37V probably damaging Het
Vwce C T 19: 10,644,221 R206C possibly damaging Het
Wrn G T 8: 33,319,172 F265L probably damaging Het
Zfp472 T A 17: 32,978,389 C479* probably null Het
Zfp831 A T 2: 174,643,858 T109S possibly damaging Het
Znfx1 G T 2: 167,056,726 Q93K probably benign Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense not run
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGAAATGAGTTGCTGTAGAAAGC -3'
(R):5'- AACTAGAGAGCTTTCATCTTGCAC -3'

Sequencing Primer
(F):5'- GAAAGCACTTTCTGTTCTTAGCTC -3'
(R):5'- ATCTTGCACACTTTTTATTCACTCAC -3'
Posted On 2017-10-10