Mutagenetix > Incidental Mutation

Incidental Mutation 'R6158:Zfp831'

489686

Institutional Source

Beutler Lab

Gene Symbol

Zfp831

Ensembl Gene

ENSMUSG00000050600

Gene Name

zinc finger protein 831

Synonyms

ENSMUSG00000050600, OTTMUSG00000017459

MMRRC Submission

044305-MU

Accession Numbers

Genbank: NM_001099328; MGI: 3641861

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6158 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

174643534-174710832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 174643858 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 109 (T109S)

Ref Sequence

ENSEMBL: ENSMUSP00000060255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059452]

AlphaFold

A2ADM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059452
AA Change: T109S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000060255
Gene: ENSMUSG00000050600
AA Change: T109S

Domain	Start	End	E-Value	Type
low complexity region	120	135	N/A	INTRINSIC
ZnF_C2H2	143	165	5.06e-2	SMART
ZnF_C2H2	171	195	7.78e-3	SMART
low complexity region	201	216	N/A	INTRINSIC
low complexity region	237	248	N/A	INTRINSIC
low complexity region	345	371	N/A	INTRINSIC
low complexity region	383	392	N/A	INTRINSIC
low complexity region	447	459	N/A	INTRINSIC
low complexity region	645	657	N/A	INTRINSIC
low complexity region	717	736	N/A	INTRINSIC
low complexity region	856	870	N/A	INTRINSIC
low complexity region	1520	1529	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.5%
20x: 92.6%

Validation Efficiency

98% (65/66)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,170,636	V793A	possibly damaging	Het
2900092C05Rik	A	G	7: 12,512,672	T32A	probably benign	Het
Adprhl1	C	T	8: 13,224,977	V594M	possibly damaging	Het
Ano3	A	T	2: 110,665,875	Y845N	probably damaging	Het
Arhgap24	A	T	5: 102,892,912	I575L	probably benign	Het
Aurka	A	C	2: 172,363,596		probably null	Het
C1qtnf5	A	T	9: 44,108,970		probably benign	Het
Cacnb2	A	G	2: 14,985,601	D454G	possibly damaging	Het
Ccdc58	T	A	16: 36,089,929	V118D	probably damaging	Het
Chchd5	T	C	2: 129,130,517	L87P	probably damaging	Het
Col7a1	G	T	9: 108,964,603	R1377L	unknown	Het
Cpne8	A	C	15: 90,571,988	S191A	probably damaging	Het
Dhx30	A	T	9: 110,087,030	I671N	probably damaging	Het
Dnah12	A	T	14: 26,773,685	K1423N	possibly damaging	Het
Dnm3	T	C	1: 162,320,987	M272V	probably damaging	Het
Fat4	A	T	3: 38,983,262	S3688C	possibly damaging	Het
Frmpd1	A	T	4: 45,285,401	L1407F	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Gm11565	T	A	11: 99,914,918	C45*	probably null	Het
Gngt1	A	T	6: 3,994,311	R30*	probably null	Het
Htt	T	C	5: 34,907,086	I2943T	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lmo7	T	A	14: 101,900,137	D247E	probably benign	Het
Mastl	G	T	2: 23,132,772	N646K	possibly damaging	Het
Mei4	G	T	9: 81,927,576	L237F	probably damaging	Het
Mettl27	C	T	5: 134,940,576	P170S	possibly damaging	Het
Mgam	T	A	6: 40,757,714	I896K	probably damaging	Het
Moxd1	T	A	10: 24,284,777	C443S	probably damaging	Het
Myo18b	A	T	5: 112,874,172	N451K	probably benign	Het
Myo7b	T	C	18: 31,988,549	I768V	probably benign	Het
Nos1	A	C	5: 117,867,574	I120L	probably benign	Het
Nsd1	T	C	13: 55,245,621	V345A	probably benign	Het
Olfr1095	A	G	2: 86,851,515	L61P	possibly damaging	Het
Olfr1205	T	C	2: 88,831,146	F10L	probably damaging	Het
Olfr150	C	T	9: 39,737,076	T87I	probably benign	Het
Olfr170	C	A	16: 19,605,925	V248F	probably damaging	Het
Olfr344	A	T	2: 36,569,116	T173S	probably benign	Het
Pdzph1	T	G	17: 58,973,627	Q553H	probably damaging	Het
Piwil1	T	A	5: 128,747,876	L546*	probably null	Het
Pla2g4f	T	C	2: 120,301,071	T724A	probably benign	Het
Ralgapa2	A	T	2: 146,424,676	M660K	possibly damaging	Het
Rgsl1	T	C	1: 153,804,021	D103G	possibly damaging	Het
Rnf186	A	G	4: 138,967,254	D35G	probably damaging	Het
Rock2	A	G	12: 16,954,918	D424G	probably benign	Het
Scg2	A	T	1: 79,435,400	D495E	probably damaging	Het
Slc39a2	G	A	14: 51,894,224		probably null	Het
Snrnp48	T	A	13: 38,210,236	Y100*	probably null	Het
Spaca1	A	G	4: 34,029,176	M99T	probably damaging	Het
Specc1	T	G	11: 62,118,124	F235L	probably damaging	Het
St13	A	T	15: 81,399,601		probably null	Het
Swap70	T	A	7: 110,270,023	M341K	probably damaging	Het
Synj2	A	G	17: 5,986,212	D67G	probably benign	Het
Tmem135	T	A	7: 89,156,444	I251F	probably benign	Het
Tmem87a	A	T	2: 120,360,103		probably null	Het
Tom1l2	C	T	11: 60,232,927	D128N	probably damaging	Het
Tpx2	C	A	2: 152,873,104	H82N	probably benign	Het
Trip12	A	T	1: 84,761,012	C738S	possibly damaging	Het
Ttyh1	A	G	7: 4,125,562	T153A	probably benign	Het
Utrn	C	T	10: 12,690,822	G1199S	probably benign	Het
Vmn1r8	T	A	6: 57,036,289	N108K	probably benign	Het
Vmn2r63	T	A	7: 42,933,680	D37V	probably damaging	Het
Vwce	C	T	19: 10,644,221	R206C	possibly damaging	Het
Wrn	G	T	8: 33,319,172	F265L	probably damaging	Het
Zfp472	T	A	17: 32,978,389	C479*	probably null	Het
Znfx1	G	T	2: 167,056,726	Q93K	probably benign	Het

Other mutations in Zfp831

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Zfp831	APN	2	174646285	missense	possibly damaging	0.86
IGL00091:Zfp831	APN	2	174645658	missense	possibly damaging	0.73
IGL00764:Zfp831	APN	2	174645908	missense	possibly damaging	0.72
IGL01538:Zfp831	APN	2	174644606	missense	possibly damaging	0.72
IGL01700:Zfp831	APN	2	174644918	missense	possibly damaging	0.86
IGL01718:Zfp831	APN	2	174643838	missense	possibly damaging	0.86
IGL02221:Zfp831	APN	2	174643726	missense	probably benign	0.33
IGL02250:Zfp831	APN	2	174648201	missense	possibly damaging	0.53
IGL03209:Zfp831	APN	2	174645266	missense	probably benign	0.40
D4043:Zfp831	UTSW	2	174645266	missense	probably benign	0.40
FR4304:Zfp831	UTSW	2	174645481	small insertion	probably benign
FR4340:Zfp831	UTSW	2	174645480	small insertion	probably benign
FR4449:Zfp831	UTSW	2	174645471	small insertion	probably benign
FR4449:Zfp831	UTSW	2	174645482	small insertion	probably benign
FR4589:Zfp831	UTSW	2	174645468	small insertion	probably benign
FR4737:Zfp831	UTSW	2	174645471	small insertion	probably benign
FR4737:Zfp831	UTSW	2	174645476	small insertion	probably benign
FR4737:Zfp831	UTSW	2	174645483	small insertion	probably benign
IGL02802:Zfp831	UTSW	2	174645152	missense	possibly damaging	0.73
P0028:Zfp831	UTSW	2	174645346	missense	possibly damaging	0.53
PIT4531001:Zfp831	UTSW	2	174646723	missense	possibly damaging	0.90
R0631:Zfp831	UTSW	2	174645290	missense	possibly damaging	0.53
R0644:Zfp831	UTSW	2	174645863	missense	probably benign	0.33
R0782:Zfp831	UTSW	2	174646630	missense	probably benign	0.06
R1156:Zfp831	UTSW	2	174646917	missense	possibly damaging	0.53
R1280:Zfp831	UTSW	2	174704059	missense	probably benign	0.00
R1709:Zfp831	UTSW	2	174645890	missense	probably benign	0.33
R1883:Zfp831	UTSW	2	174704077	missense	possibly damaging	0.53
R1884:Zfp831	UTSW	2	174704077	missense	possibly damaging	0.53
R2127:Zfp831	UTSW	2	174648124	missense	probably benign	0.33
R2137:Zfp831	UTSW	2	174705746	missense	possibly damaging	0.53
R2268:Zfp831	UTSW	2	174644241	missense	probably benign	0.01
R2330:Zfp831	UTSW	2	174648089	nonsense	probably null
R3547:Zfp831	UTSW	2	174657683	missense	probably benign
R3821:Zfp831	UTSW	2	174644023	missense	possibly damaging	0.73
R4163:Zfp831	UTSW	2	174644029	missense	possibly damaging	0.53
R4232:Zfp831	UTSW	2	174705654	missense	possibly damaging	0.96
R4778:Zfp831	UTSW	2	174646807	missense	possibly damaging	0.53
R4820:Zfp831	UTSW	2	174705304	missense	possibly damaging	0.73
R4912:Zfp831	UTSW	2	174644624	missense	probably damaging	1.00
R5119:Zfp831	UTSW	2	174705310	missense	probably benign	0.18
R5152:Zfp831	UTSW	2	174644564	missense	probably benign	0.33
R5723:Zfp831	UTSW	2	174645407	missense	probably benign	0.23
R5741:Zfp831	UTSW	2	174645152	missense	possibly damaging	0.73
R5888:Zfp831	UTSW	2	174643627	missense	probably benign	0.18
R5975:Zfp831	UTSW	2	174644092	missense	possibly damaging	0.93
R6092:Zfp831	UTSW	2	174705506	missense	probably damaging	0.98
R6212:Zfp831	UTSW	2	174645868	missense	possibly damaging	0.53
R6233:Zfp831	UTSW	2	174646697	missense	possibly damaging	0.85
R6248:Zfp831	UTSW	2	174644515	missense	possibly damaging	0.53
R6255:Zfp831	UTSW	2	174646421	missense	possibly damaging	0.96
R6460:Zfp831	UTSW	2	174646567	missense	possibly damaging	0.46
R6477:Zfp831	UTSW	2	174704167	missense	probably benign
R6864:Zfp831	UTSW	2	174646740	missense	possibly damaging	0.72
R7396:Zfp831	UTSW	2	174645209	missense	possibly damaging	0.73
R7447:Zfp831	UTSW	2	174646103	missense	possibly damaging	0.88
R7499:Zfp831	UTSW	2	174644023	missense	possibly damaging	0.73
R7662:Zfp831	UTSW	2	174646141	missense	possibly damaging	0.85
R7857:Zfp831	UTSW	2	174705242	missense	probably benign	0.33
R7889:Zfp831	UTSW	2	174645304	missense	possibly damaging	0.53
R7896:Zfp831	UTSW	2	174647128	missense	possibly damaging	0.53
R8074:Zfp831	UTSW	2	174644735	missense	possibly damaging	0.72
R8089:Zfp831	UTSW	2	174644924	missense	possibly damaging	0.96
R8438:Zfp831	UTSW	2	174645003	missense	possibly damaging	0.53
R8716:Zfp831	UTSW	2	174705256	missense	possibly damaging	0.53
R8757:Zfp831	UTSW	2	174646081	missense	probably benign
R8759:Zfp831	UTSW	2	174646081	missense	probably benign
R8899:Zfp831	UTSW	2	174644185	missense	probably damaging	0.97
R8976:Zfp831	UTSW	2	174645286	missense	possibly damaging	0.76
R9146:Zfp831	UTSW	2	174645668	missense	possibly damaging	0.72
R9257:Zfp831	UTSW	2	174646363	missense	possibly damaging	0.53
R9324:Zfp831	UTSW	2	174705320	missense	probably benign	0.33
R9467:Zfp831	UTSW	2	174644996	missense	probably benign	0.33
R9729:Zfp831	UTSW	2	174646145	missense	possibly damaging	0.96
X0021:Zfp831	UTSW	2	174705869	missense	possibly damaging	0.85
Z1177:Zfp831	UTSW	2	174644188	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CCCAACTGTGTTCTTGAAGGC -3'
(R):5'- TGGGTCTTAAAGGCGATGC -3'

Sequencing Primer
(F):5'- CAACTGTGTTCTTGAAGGCATTGC -3'
(R):5'- AAGGGCCTTTCACCTGTG -3'

Posted On

2017-10-10