Mutagenetix > Incidental Mutation

Incidental Mutation 'R6158:Spaca1'

489688

Institutional Source

Beutler Lab

Gene Symbol

Spaca1

Ensembl Gene

ENSMUSG00000028264

Gene Name

sperm acrosome associated 1

Synonyms

1700124L11Rik, 4930540L03Rik

MMRRC Submission

044305-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6158 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34024874-34050191 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34029176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 99 (M99T)

Ref Sequence

ENSEMBL: ENSMUSP00000103783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734] [ENSMUST00000108148]

AlphaFold

Q9DA48

Predicted Effect

probably damaging
Transcript: ENSMUST00000029927
AA Change: M217T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264
AA Change: M217T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	46	79	N/A	INTRINSIC
transmembrane domain	228	250	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000084734
AA Change: M217T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264
AA Change: M217T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	46	79	N/A	INTRINSIC
transmembrane domain	228	250	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108148
AA Change: M99T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103783
Gene: ENSMUSG00000028264
AA Change: M99T

Domain	Start	End	E-Value	Type
transmembrane domain	109	131	N/A	INTRINSIC

Meta Mutation Damage Score

0.1317

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.5%
20x: 92.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,170,636	V793A	possibly damaging	Het
2900092C05Rik	A	G	7: 12,512,672	T32A	probably benign	Het
Adprhl1	C	T	8: 13,224,977	V594M	possibly damaging	Het
Ano3	A	T	2: 110,665,875	Y845N	probably damaging	Het
Arhgap24	A	T	5: 102,892,912	I575L	probably benign	Het
Aurka	A	C	2: 172,363,596		probably null	Het
C1qtnf5	A	T	9: 44,108,970		probably benign	Het
Cacnb2	A	G	2: 14,985,601	D454G	possibly damaging	Het
Ccdc58	T	A	16: 36,089,929	V118D	probably damaging	Het
Chchd5	T	C	2: 129,130,517	L87P	probably damaging	Het
Col7a1	G	T	9: 108,964,603	R1377L	unknown	Het
Cpne8	A	C	15: 90,571,988	S191A	probably damaging	Het
Dhx30	A	T	9: 110,087,030	I671N	probably damaging	Het
Dnah12	A	T	14: 26,773,685	K1423N	possibly damaging	Het
Dnm3	T	C	1: 162,320,987	M272V	probably damaging	Het
Fat4	A	T	3: 38,983,262	S3688C	possibly damaging	Het
Frmpd1	A	T	4: 45,285,401	L1407F	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Gm11565	T	A	11: 99,914,918	C45*	probably null	Het
Gngt1	A	T	6: 3,994,311	R30*	probably null	Het
Htt	T	C	5: 34,907,086	I2943T	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lmo7	T	A	14: 101,900,137	D247E	probably benign	Het
Mastl	G	T	2: 23,132,772	N646K	possibly damaging	Het
Mei4	G	T	9: 81,927,576	L237F	probably damaging	Het
Mettl27	C	T	5: 134,940,576	P170S	possibly damaging	Het
Mgam	T	A	6: 40,757,714	I896K	probably damaging	Het
Moxd1	T	A	10: 24,284,777	C443S	probably damaging	Het
Myo18b	A	T	5: 112,874,172	N451K	probably benign	Het
Myo7b	T	C	18: 31,988,549	I768V	probably benign	Het
Nos1	A	C	5: 117,867,574	I120L	probably benign	Het
Nsd1	T	C	13: 55,245,621	V345A	probably benign	Het
Olfr1095	A	G	2: 86,851,515	L61P	possibly damaging	Het
Olfr1205	T	C	2: 88,831,146	F10L	probably damaging	Het
Olfr150	C	T	9: 39,737,076	T87I	probably benign	Het
Olfr170	C	A	16: 19,605,925	V248F	probably damaging	Het
Olfr344	A	T	2: 36,569,116	T173S	probably benign	Het
Pdzph1	T	G	17: 58,973,627	Q553H	probably damaging	Het
Piwil1	T	A	5: 128,747,876	L546*	probably null	Het
Pla2g4f	T	C	2: 120,301,071	T724A	probably benign	Het
Ralgapa2	A	T	2: 146,424,676	M660K	possibly damaging	Het
Rgsl1	T	C	1: 153,804,021	D103G	possibly damaging	Het
Rnf186	A	G	4: 138,967,254	D35G	probably damaging	Het
Rock2	A	G	12: 16,954,918	D424G	probably benign	Het
Scg2	A	T	1: 79,435,400	D495E	probably damaging	Het
Slc39a2	G	A	14: 51,894,224		probably null	Het
Snrnp48	T	A	13: 38,210,236	Y100*	probably null	Het
Specc1	T	G	11: 62,118,124	F235L	probably damaging	Het
St13	A	T	15: 81,399,601		probably null	Het
Swap70	T	A	7: 110,270,023	M341K	probably damaging	Het
Synj2	A	G	17: 5,986,212	D67G	probably benign	Het
Tmem135	T	A	7: 89,156,444	I251F	probably benign	Het
Tmem87a	A	T	2: 120,360,103		probably null	Het
Tom1l2	C	T	11: 60,232,927	D128N	probably damaging	Het
Tpx2	C	A	2: 152,873,104	H82N	probably benign	Het
Trip12	A	T	1: 84,761,012	C738S	possibly damaging	Het
Ttyh1	A	G	7: 4,125,562	T153A	probably benign	Het
Utrn	C	T	10: 12,690,822	G1199S	probably benign	Het
Vmn1r8	T	A	6: 57,036,289	N108K	probably benign	Het
Vmn2r63	T	A	7: 42,933,680	D37V	probably damaging	Het
Vwce	C	T	19: 10,644,221	R206C	possibly damaging	Het
Wrn	G	T	8: 33,319,172	F265L	probably damaging	Het
Zfp472	T	A	17: 32,978,389	C479*	probably null	Het
Zfp831	A	T	2: 174,643,858	T109S	possibly damaging	Het
Znfx1	G	T	2: 167,056,726	Q93K	probably benign	Het

Other mutations in Spaca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Spaca1	APN	4	34029077	missense	probably damaging	0.99
IGL01871:Spaca1	APN	4	34040894	missense	probably damaging	0.98
F5770:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
FR4342:Spaca1	UTSW	4	34049838	small insertion	probably benign
FR4548:Spaca1	UTSW	4	34049856	small insertion	probably benign
FR4737:Spaca1	UTSW	4	34049836	small insertion	probably benign
FR4976:Spaca1	UTSW	4	34049844	small insertion	probably benign
FR4976:Spaca1	UTSW	4	34049849	small insertion	probably benign
R0377:Spaca1	UTSW	4	34044267	splice site	probably null
R1861:Spaca1	UTSW	4	34044206	missense	probably damaging	0.99
R3105:Spaca1	UTSW	4	34028468	missense	probably damaging	1.00
R4930:Spaca1	UTSW	4	34044236	missense	possibly damaging	0.65
R5030:Spaca1	UTSW	4	34039247	missense	possibly damaging	0.65
R5137:Spaca1	UTSW	4	34029095	missense	probably damaging	1.00
R5264:Spaca1	UTSW	4	34049863	missense	possibly damaging	0.53
R6824:Spaca1	UTSW	4	34049869	missense	probably benign	0.00
R8039:Spaca1	UTSW	4	34044207	missense	probably damaging	0.99
R8094:Spaca1	UTSW	4	34049837	missense	possibly damaging	0.55
R8134:Spaca1	UTSW	4	34042157	splice site	probably null
R9120:Spaca1	UTSW	4	34029168	missense	probably damaging	0.97
RF006:Spaca1	UTSW	4	34049853	small insertion	probably benign
RF017:Spaca1	UTSW	4	34049853	small insertion	probably benign
RF032:Spaca1	UTSW	4	34049854	small insertion	probably benign
RF043:Spaca1	UTSW	4	34049846	small insertion	probably benign
RF044:Spaca1	UTSW	4	34049846	small insertion	probably benign
RF044:Spaca1	UTSW	4	34049854	small insertion	probably benign
RF060:Spaca1	UTSW	4	34049841	small insertion	probably benign
V7580:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
V7581:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
V7582:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99
V7583:Spaca1	UTSW	4	34039311	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTCACTGCAAATGCGTGGG -3'
(R):5'- CCAGGATAGTCTGTTTGAGAAAGTC -3'

Sequencing Primer
(F):5'- ACTGCAAATGCGTGGGGATTG -3'
(R):5'- GAGAAAGTCCTCTTCCCAGCTTG -3'

Posted On

2017-10-10