Mutagenetix > Incidental Mutation

Incidental Mutation 'R6158:Kl'

489698

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000058488

Gene Name

klotho

Synonyms

alpha-kl

MMRRC Submission

044305-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6158 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150952607-150993817 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 150988853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 689 (M689K)

Ref Sequence

ENSEMBL: ENSMUSP00000077899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078856]

AlphaFold

O35082

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078856
AA Change: M689K

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000077899
Gene: ENSMUSG00000058488
AA Change: M689K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	45	56	N/A	INTRINSIC
Pfam:Glyco_hydro_1	59	380	4.3e-99	PFAM
Pfam:Glyco_hydro_1	376	508	7.9e-33	PFAM
Pfam:Glyco_hydro_1	517	955	1e-79	PFAM
transmembrane domain	984	1006	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202096

Meta Mutation Damage Score

0.8842

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.5%
20x: 92.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I membrane protein that is related to beta-glucosidases. Reduced production of this protein has been observed in patients with chronic renal failure (CRF), and this may be one of the factors underlying the degenerative processes (e.g., arteriosclerosis, osteoporosis, and skin atrophy) seen in CRF. Also, mutations within this protein have been associated with ageing and bone loss. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have a short lifespan and growth retardation with one allele homeostatic imbalances and soft tissue calcification are also seen. With a second allele abnormal cancellous bone and femur morphology are seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,170,636	V793A	possibly damaging	Het
2900092C05Rik	A	G	7: 12,512,672	T32A	probably benign	Het
Adprhl1	C	T	8: 13,224,977	V594M	possibly damaging	Het
Ano3	A	T	2: 110,665,875	Y845N	probably damaging	Het
Arhgap24	A	T	5: 102,892,912	I575L	probably benign	Het
Aurka	A	C	2: 172,363,596		probably null	Het
C1qtnf5	A	T	9: 44,108,970		probably benign	Het
Cacnb2	A	G	2: 14,985,601	D454G	possibly damaging	Het
Ccdc58	T	A	16: 36,089,929	V118D	probably damaging	Het
Chchd5	T	C	2: 129,130,517	L87P	probably damaging	Het
Col7a1	G	T	9: 108,964,603	R1377L	unknown	Het
Cpne8	A	C	15: 90,571,988	S191A	probably damaging	Het
Dhx30	A	T	9: 110,087,030	I671N	probably damaging	Het
Dnah12	A	T	14: 26,773,685	K1423N	possibly damaging	Het
Dnm3	T	C	1: 162,320,987	M272V	probably damaging	Het
Fat4	A	T	3: 38,983,262	S3688C	possibly damaging	Het
Frmpd1	A	T	4: 45,285,401	L1407F	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Gm11565	T	A	11: 99,914,918	C45*	probably null	Het
Gngt1	A	T	6: 3,994,311	R30*	probably null	Het
Htt	T	C	5: 34,907,086	I2943T	possibly damaging	Het
Lmo7	T	A	14: 101,900,137	D247E	probably benign	Het
Mastl	G	T	2: 23,132,772	N646K	possibly damaging	Het
Mei4	G	T	9: 81,927,576	L237F	probably damaging	Het
Mettl27	C	T	5: 134,940,576	P170S	possibly damaging	Het
Mgam	T	A	6: 40,757,714	I896K	probably damaging	Het
Moxd1	T	A	10: 24,284,777	C443S	probably damaging	Het
Myo18b	A	T	5: 112,874,172	N451K	probably benign	Het
Myo7b	T	C	18: 31,988,549	I768V	probably benign	Het
Nos1	A	C	5: 117,867,574	I120L	probably benign	Het
Nsd1	T	C	13: 55,245,621	V345A	probably benign	Het
Olfr1095	A	G	2: 86,851,515	L61P	possibly damaging	Het
Olfr1205	T	C	2: 88,831,146	F10L	probably damaging	Het
Olfr150	C	T	9: 39,737,076	T87I	probably benign	Het
Olfr170	C	A	16: 19,605,925	V248F	probably damaging	Het
Olfr344	A	T	2: 36,569,116	T173S	probably benign	Het
Pdzph1	T	G	17: 58,973,627	Q553H	probably damaging	Het
Piwil1	T	A	5: 128,747,876	L546*	probably null	Het
Pla2g4f	T	C	2: 120,301,071	T724A	probably benign	Het
Ralgapa2	A	T	2: 146,424,676	M660K	possibly damaging	Het
Rgsl1	T	C	1: 153,804,021	D103G	possibly damaging	Het
Rnf186	A	G	4: 138,967,254	D35G	probably damaging	Het
Rock2	A	G	12: 16,954,918	D424G	probably benign	Het
Scg2	A	T	1: 79,435,400	D495E	probably damaging	Het
Slc39a2	G	A	14: 51,894,224		probably null	Het
Snrnp48	T	A	13: 38,210,236	Y100*	probably null	Het
Spaca1	A	G	4: 34,029,176	M99T	probably damaging	Het
Specc1	T	G	11: 62,118,124	F235L	probably damaging	Het
St13	A	T	15: 81,399,601		probably null	Het
Swap70	T	A	7: 110,270,023	M341K	probably damaging	Het
Synj2	A	G	17: 5,986,212	D67G	probably benign	Het
Tmem135	T	A	7: 89,156,444	I251F	probably benign	Het
Tmem87a	A	T	2: 120,360,103		probably null	Het
Tom1l2	C	T	11: 60,232,927	D128N	probably damaging	Het
Tpx2	C	A	2: 152,873,104	H82N	probably benign	Het
Trip12	A	T	1: 84,761,012	C738S	possibly damaging	Het
Ttyh1	A	G	7: 4,125,562	T153A	probably benign	Het
Utrn	C	T	10: 12,690,822	G1199S	probably benign	Het
Vmn1r8	T	A	6: 57,036,289	N108K	probably benign	Het
Vmn2r63	T	A	7: 42,933,680	D37V	probably damaging	Het
Vwce	C	T	19: 10,644,221	R206C	possibly damaging	Het
Wrn	G	T	8: 33,319,172	F265L	probably damaging	Het
Zfp472	T	A	17: 32,978,389	C479*	probably null	Het
Zfp831	A	T	2: 174,643,858	T109S	possibly damaging	Het
Znfx1	G	T	2: 167,056,726	Q93K	probably benign	Het

Other mutations in Kl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00800:Kl	APN	5	150980768	nonsense	probably null
IGL00815:Kl	APN	5	150980850	missense	possibly damaging	0.55
IGL00840:Kl	APN	5	150980787	missense	possibly damaging	0.90
IGL01347:Kl	APN	5	150980665	missense	probably damaging	1.00
IGL01642:Kl	APN	5	150980869	missense	possibly damaging	0.58
IGL01774:Kl	APN	5	150988483	missense	probably benign	0.00
IGL01937:Kl	APN	5	150988937	missense	probably damaging	0.99
IGL01945:Kl	APN	5	150988937	missense	probably damaging	0.99
IGL02510:Kl	APN	5	150989001	missense	probably damaging	1.00
IGL02696:Kl	APN	5	150980985	missense	probably benign	0.01
IGL03028:Kl	APN	5	150991550	missense	probably damaging	1.00
IGL03149:Kl	APN	5	150982735	nonsense	probably null
anatolia	UTSW	5	150988853	missense	possibly damaging	0.69
ararat	UTSW	5	150988853	missense	possibly damaging	0.69
Turkic	UTSW	5	150953290	missense	probably damaging	1.00
R0480:Kl	UTSW	5	150953288	missense	probably damaging	1.00
R0565:Kl	UTSW	5	150980944	missense	possibly damaging	0.76
R0723:Kl	UTSW	5	150953101	missense	probably damaging	1.00
R1052:Kl	UTSW	5	150982520	missense	probably damaging	1.00
R1205:Kl	UTSW	5	150980688	missense	probably damaging	1.00
R1512:Kl	UTSW	5	150988597	missense	probably benign	0.00
R1529:Kl	UTSW	5	150988941	missense	probably benign
R1588:Kl	UTSW	5	150982632	missense	probably benign	0.20
R1714:Kl	UTSW	5	150953333	missense	probably benign	0.05
R1748:Kl	UTSW	5	150980985	missense	possibly damaging	0.87
R1885:Kl	UTSW	5	150953494	missense	possibly damaging	0.67
R1920:Kl	UTSW	5	150982667	missense	probably benign	0.15
R2156:Kl	UTSW	5	150988960	missense	probably benign	0.41
R2926:Kl	UTSW	5	150953341	missense	probably damaging	1.00
R4837:Kl	UTSW	5	150980847	missense	possibly damaging	0.90
R5221:Kl	UTSW	5	150989151	missense	probably damaging	1.00
R5687:Kl	UTSW	5	150988466	missense	possibly damaging	0.84
R5726:Kl	UTSW	5	150991538	missense	possibly damaging	0.91
R5727:Kl	UTSW	5	150991538	missense	possibly damaging	0.91
R5735:Kl	UTSW	5	150991538	missense	possibly damaging	0.91
R5797:Kl	UTSW	5	150991538	missense	possibly damaging	0.91
R5933:Kl	UTSW	5	150989483	missense	probably damaging	1.00
R6075:Kl	UTSW	5	150953001	missense	probably damaging	1.00
R6076:Kl	UTSW	5	150953001	missense	probably damaging	1.00
R6077:Kl	UTSW	5	150953001	missense	probably damaging	1.00
R6149:Kl	UTSW	5	150988853	missense	possibly damaging	0.69
R6150:Kl	UTSW	5	150988853	missense	possibly damaging	0.69
R6151:Kl	UTSW	5	150988853	missense	possibly damaging	0.69
R6236:Kl	UTSW	5	150953290	missense	probably damaging	1.00
R6609:Kl	UTSW	5	150988962	missense	probably benign	0.00
R7489:Kl	UTSW	5	150952996	missense	probably damaging	1.00
R8406:Kl	UTSW	5	150982764	missense	probably benign	0.01
R9026:Kl	UTSW	5	150953026	missense	probably benign	0.23
R9087:Kl	UTSW	5	150988492	missense	probably benign	0.19
R9380:Kl	UTSW	5	150988877	missense	possibly damaging	0.50
RF005:Kl	UTSW	5	150953420	missense	probably benign	0.07
RF024:Kl	UTSW	5	150953420	missense	probably benign	0.07
X0066:Kl	UTSW	5	150991615	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACGGTTCTGCACTTCTACCG -3'
(R):5'- CTTTGTCATTTTGAGAGAAAGGGC -3'

Sequencing Primer
(F):5'- TGCATGATCAGCGAGCTG -3'
(R):5'- AAAGGGCAGGCCGGTTCTATC -3'

Posted On

2017-10-10