Mutagenetix > Incidental Mutation

Incidental Mutation 'R6158:Mgam'

489700

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

044305-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R6158 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40757714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 896 (I896K)

Ref Sequence

ENSEMBL: ENSMUSP00000144627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071535
AA Change: I1523K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: I1523K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201148
AA Change: I1523K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: I1523K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202775

Predicted Effect

probably damaging
Transcript: ENSMUST00000202779
AA Change: I896K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: I896K

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202966
AA Change: I777K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: I777K

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Meta Mutation Damage Score

0.4231

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.5%
20x: 92.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,170,636	V793A	possibly damaging	Het
2900092C05Rik	A	G	7: 12,512,672	T32A	probably benign	Het
Adprhl1	C	T	8: 13,224,977	V594M	possibly damaging	Het
Ano3	A	T	2: 110,665,875	Y845N	probably damaging	Het
Arhgap24	A	T	5: 102,892,912	I575L	probably benign	Het
Aurka	A	C	2: 172,363,596		probably null	Het
C1qtnf5	A	T	9: 44,108,970		probably benign	Het
Cacnb2	A	G	2: 14,985,601	D454G	possibly damaging	Het
Ccdc58	T	A	16: 36,089,929	V118D	probably damaging	Het
Chchd5	T	C	2: 129,130,517	L87P	probably damaging	Het
Col7a1	G	T	9: 108,964,603	R1377L	unknown	Het
Cpne8	A	C	15: 90,571,988	S191A	probably damaging	Het
Dhx30	A	T	9: 110,087,030	I671N	probably damaging	Het
Dnah12	A	T	14: 26,773,685	K1423N	possibly damaging	Het
Dnm3	T	C	1: 162,320,987	M272V	probably damaging	Het
Fat4	A	T	3: 38,983,262	S3688C	possibly damaging	Het
Frmpd1	A	T	4: 45,285,401	L1407F	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Gm11565	T	A	11: 99,914,918	C45*	probably null	Het
Gngt1	A	T	6: 3,994,311	R30*	probably null	Het
Htt	T	C	5: 34,907,086	I2943T	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lmo7	T	A	14: 101,900,137	D247E	probably benign	Het
Mastl	G	T	2: 23,132,772	N646K	possibly damaging	Het
Mei4	G	T	9: 81,927,576	L237F	probably damaging	Het
Mettl27	C	T	5: 134,940,576	P170S	possibly damaging	Het
Moxd1	T	A	10: 24,284,777	C443S	probably damaging	Het
Myo18b	A	T	5: 112,874,172	N451K	probably benign	Het
Myo7b	T	C	18: 31,988,549	I768V	probably benign	Het
Nos1	A	C	5: 117,867,574	I120L	probably benign	Het
Nsd1	T	C	13: 55,245,621	V345A	probably benign	Het
Olfr1095	A	G	2: 86,851,515	L61P	possibly damaging	Het
Olfr1205	T	C	2: 88,831,146	F10L	probably damaging	Het
Olfr150	C	T	9: 39,737,076	T87I	probably benign	Het
Olfr170	C	A	16: 19,605,925	V248F	probably damaging	Het
Olfr344	A	T	2: 36,569,116	T173S	probably benign	Het
Pdzph1	T	G	17: 58,973,627	Q553H	probably damaging	Het
Piwil1	T	A	5: 128,747,876	L546*	probably null	Het
Pla2g4f	T	C	2: 120,301,071	T724A	probably benign	Het
Ralgapa2	A	T	2: 146,424,676	M660K	possibly damaging	Het
Rgsl1	T	C	1: 153,804,021	D103G	possibly damaging	Het
Rnf186	A	G	4: 138,967,254	D35G	probably damaging	Het
Rock2	A	G	12: 16,954,918	D424G	probably benign	Het
Scg2	A	T	1: 79,435,400	D495E	probably damaging	Het
Slc39a2	G	A	14: 51,894,224		probably null	Het
Snrnp48	T	A	13: 38,210,236	Y100*	probably null	Het
Spaca1	A	G	4: 34,029,176	M99T	probably damaging	Het
Specc1	T	G	11: 62,118,124	F235L	probably damaging	Het
St13	A	T	15: 81,399,601		probably null	Het
Swap70	T	A	7: 110,270,023	M341K	probably damaging	Het
Synj2	A	G	17: 5,986,212	D67G	probably benign	Het
Tmem135	T	A	7: 89,156,444	I251F	probably benign	Het
Tmem87a	A	T	2: 120,360,103		probably null	Het
Tom1l2	C	T	11: 60,232,927	D128N	probably damaging	Het
Tpx2	C	A	2: 152,873,104	H82N	probably benign	Het
Trip12	A	T	1: 84,761,012	C738S	possibly damaging	Het
Ttyh1	A	G	7: 4,125,562	T153A	probably benign	Het
Utrn	C	T	10: 12,690,822	G1199S	probably benign	Het
Vmn1r8	T	A	6: 57,036,289	N108K	probably benign	Het
Vmn2r63	T	A	7: 42,933,680	D37V	probably damaging	Het
Vwce	C	T	19: 10,644,221	R206C	possibly damaging	Het
Wrn	G	T	8: 33,319,172	F265L	probably damaging	Het
Zfp472	T	A	17: 32,978,389	C479*	probably null	Het
Zfp831	A	T	2: 174,643,858	T109S	possibly damaging	Het
Znfx1	G	T	2: 167,056,726	Q93K	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8758:Mgam	UTSW	6	40729043	missense	probably benign	0.41
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8783:Mgam	UTSW	6	40656489	missense	probably damaging	0.99
R8939:Mgam	UTSW	6	40763203	critical splice donor site	probably null
R8968:Mgam	UTSW	6	40757811	critical splice acceptor site	probably null
R8987:Mgam	UTSW	6	40729636	missense	probably damaging	1.00
R9055:Mgam	UTSW	6	40714729	intron	probably benign
R9171:Mgam	UTSW	6	40768212	missense	possibly damaging	0.76
R9252:Mgam	UTSW	6	40729643	missense	probably damaging	0.99
R9258:Mgam	UTSW	6	40680187	missense	probably benign
R9262:Mgam	UTSW	6	40746488	critical splice donor site	probably null
R9287:Mgam	UTSW	6	40728971	intron	probably benign
R9521:Mgam	UTSW	6	40745184	missense	probably damaging	1.00
R9589:Mgam	UTSW	6	40750585	missense	probably damaging	1.00
R9658:Mgam	UTSW	6	40744377	missense	possibly damaging	0.93
R9784:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGAAATCCATCATTGGTGTG -3'
(R):5'- AAGAGACTGACATCGTACCCGG -3'

Sequencing Primer
(F):5'- AAATCCATCATTGGTGTGTGGGTG -3'
(R):5'- ACATCGTACCCGGGTCCC -3'

Posted On

2017-10-10