Mutagenetix > Incidental Mutation

Incidental Mutation 'R6158:Lmo7'

489723

Institutional Source

Beutler Lab

Gene Symbol

Lmo7

Ensembl Gene

ENSMUSG00000033060

Gene Name

LIM domain only 7

Synonyms

FBXO20, LOC380928

MMRRC Submission

044305-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R6158 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101729957-101934710 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101900137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 247 (D247E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]

AlphaFold

E9PYF4

Predicted Effect

probably benign
Transcript: ENSMUST00000100337
AA Change: D758E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: D758E

Domain	Start	End	E-Value	Type
CH	14	124	2.57e-13	SMART
low complexity region	200	211	N/A	INTRINSIC
Pfam:DUF4757	242	348	2.2e-14	PFAM
low complexity region	448	462	N/A	INTRINSIC
Pfam:DUF4757	568	735	1.8e-46	PFAM
low complexity region	861	879	N/A	INTRINSIC
low complexity region	979	991	N/A	INTRINSIC
low complexity region	1003	1015	N/A	INTRINSIC
PDZ	1047	1119	1.05e-8	SMART
coiled coil region	1222	1275	N/A	INTRINSIC
coiled coil region	1319	1411	N/A	INTRINSIC
low complexity region	1585	1596	N/A	INTRINSIC
low complexity region	1599	1617	N/A	INTRINSIC
LIM	1629	1687	6.54e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159026

SMART Domains

Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	471	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159258

SMART Domains

Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159314
AA Change: D525E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: D525E

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	492	N/A	INTRINSIC
low complexity region	628	646	N/A	INTRINSIC
low complexity region	746	758	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
PDZ	814	886	1.05e-8	SMART
coiled coil region	989	1042	N/A	INTRINSIC
coiled coil region	1086	1178	N/A	INTRINSIC
low complexity region	1352	1363	N/A	INTRINSIC
low complexity region	1366	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159597
AA Change: D636E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: D636E

Domain	Start	End	E-Value	Type
low complexity region	78	89	N/A	INTRINSIC
internal_repeat_1	111	141	6.96e-5	PROSPERO
internal_repeat_1	218	248	6.96e-5	PROSPERO
low complexity region	326	340	N/A	INTRINSIC
coiled coil region	546	603	N/A	INTRINSIC
low complexity region	739	757	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	881	893	N/A	INTRINSIC
PDZ	925	997	1.05e-8	SMART
coiled coil region	1127	1180	N/A	INTRINSIC
coiled coil region	1224	1316	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1504	1522	N/A	INTRINSIC
LIM	1534	1592	6.54e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159806
AA Change: D247E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060
AA Change: D247E

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
Pfam:DUF4757	76	225	4.5e-53	PFAM
low complexity region	351	369	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	493	505	N/A	INTRINSIC
PDZ	537	609	1.05e-8	SMART
internal_repeat_1	620	691	9.31e-5	PROSPERO
coiled coil region	711	764	N/A	INTRINSIC
coiled coil region	808	900	N/A	INTRINSIC
internal_repeat_1	921	976	9.31e-5	PROSPERO
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1089	1107	N/A	INTRINSIC
LIM	1119	1177	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159948

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160876

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.5%
20x: 92.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,170,636	V793A	possibly damaging	Het
2900092C05Rik	A	G	7: 12,512,672	T32A	probably benign	Het
Adprhl1	C	T	8: 13,224,977	V594M	possibly damaging	Het
Ano3	A	T	2: 110,665,875	Y845N	probably damaging	Het
Arhgap24	A	T	5: 102,892,912	I575L	probably benign	Het
Aurka	A	C	2: 172,363,596		probably null	Het
C1qtnf5	A	T	9: 44,108,970		probably benign	Het
Cacnb2	A	G	2: 14,985,601	D454G	possibly damaging	Het
Ccdc58	T	A	16: 36,089,929	V118D	probably damaging	Het
Chchd5	T	C	2: 129,130,517	L87P	probably damaging	Het
Col7a1	G	T	9: 108,964,603	R1377L	unknown	Het
Cpne8	A	C	15: 90,571,988	S191A	probably damaging	Het
Dhx30	A	T	9: 110,087,030	I671N	probably damaging	Het
Dnah12	A	T	14: 26,773,685	K1423N	possibly damaging	Het
Dnm3	T	C	1: 162,320,987	M272V	probably damaging	Het
Fat4	A	T	3: 38,983,262	S3688C	possibly damaging	Het
Frmpd1	A	T	4: 45,285,401	L1407F	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Gm11565	T	A	11: 99,914,918	C45*	probably null	Het
Gngt1	A	T	6: 3,994,311	R30*	probably null	Het
Htt	T	C	5: 34,907,086	I2943T	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Mastl	G	T	2: 23,132,772	N646K	possibly damaging	Het
Mei4	G	T	9: 81,927,576	L237F	probably damaging	Het
Mettl27	C	T	5: 134,940,576	P170S	possibly damaging	Het
Mgam	T	A	6: 40,757,714	I896K	probably damaging	Het
Moxd1	T	A	10: 24,284,777	C443S	probably damaging	Het
Myo18b	A	T	5: 112,874,172	N451K	probably benign	Het
Myo7b	T	C	18: 31,988,549	I768V	probably benign	Het
Nos1	A	C	5: 117,867,574	I120L	probably benign	Het
Nsd1	T	C	13: 55,245,621	V345A	probably benign	Het
Olfr1095	A	G	2: 86,851,515	L61P	possibly damaging	Het
Olfr1205	T	C	2: 88,831,146	F10L	probably damaging	Het
Olfr150	C	T	9: 39,737,076	T87I	probably benign	Het
Olfr170	C	A	16: 19,605,925	V248F	probably damaging	Het
Olfr344	A	T	2: 36,569,116	T173S	probably benign	Het
Pdzph1	T	G	17: 58,973,627	Q553H	probably damaging	Het
Piwil1	T	A	5: 128,747,876	L546*	probably null	Het
Pla2g4f	T	C	2: 120,301,071	T724A	probably benign	Het
Ralgapa2	A	T	2: 146,424,676	M660K	possibly damaging	Het
Rgsl1	T	C	1: 153,804,021	D103G	possibly damaging	Het
Rnf186	A	G	4: 138,967,254	D35G	probably damaging	Het
Rock2	A	G	12: 16,954,918	D424G	probably benign	Het
Scg2	A	T	1: 79,435,400	D495E	probably damaging	Het
Slc39a2	G	A	14: 51,894,224		probably null	Het
Snrnp48	T	A	13: 38,210,236	Y100*	probably null	Het
Spaca1	A	G	4: 34,029,176	M99T	probably damaging	Het
Specc1	T	G	11: 62,118,124	F235L	probably damaging	Het
St13	A	T	15: 81,399,601		probably null	Het
Swap70	T	A	7: 110,270,023	M341K	probably damaging	Het
Synj2	A	G	17: 5,986,212	D67G	probably benign	Het
Tmem135	T	A	7: 89,156,444	I251F	probably benign	Het
Tmem87a	A	T	2: 120,360,103		probably null	Het
Tom1l2	C	T	11: 60,232,927	D128N	probably damaging	Het
Tpx2	C	A	2: 152,873,104	H82N	probably benign	Het
Trip12	A	T	1: 84,761,012	C738S	possibly damaging	Het
Ttyh1	A	G	7: 4,125,562	T153A	probably benign	Het
Utrn	C	T	10: 12,690,822	G1199S	probably benign	Het
Vmn1r8	T	A	6: 57,036,289	N108K	probably benign	Het
Vmn2r63	T	A	7: 42,933,680	D37V	probably damaging	Het
Vwce	C	T	19: 10,644,221	R206C	possibly damaging	Het
Wrn	G	T	8: 33,319,172	F265L	probably damaging	Het
Zfp472	T	A	17: 32,978,389	C479*	probably null	Het
Zfp831	A	T	2: 174,643,858	T109S	possibly damaging	Het
Znfx1	G	T	2: 167,056,726	Q93K	probably benign	Het

Other mutations in Lmo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Lmo7	APN	14	101887051	missense	probably damaging	0.99
IGL00733:Lmo7	APN	14	101915702	missense	probably damaging	1.00
IGL00778:Lmo7	APN	14	101910885	splice site	probably benign
IGL01014:Lmo7	APN	14	101920557	splice site	probably benign
IGL01401:Lmo7	APN	14	101794277	nonsense	probably null
IGL01550:Lmo7	APN	14	101926140	utr 3 prime	probably benign
IGL01570:Lmo7	APN	14	101902371	critical splice donor site	probably null
IGL01602:Lmo7	APN	14	101910756	splice site	probably benign
IGL01605:Lmo7	APN	14	101910756	splice site	probably benign
IGL02012:Lmo7	APN	14	101888716	intron	probably benign
IGL02145:Lmo7	APN	14	101902223	missense	probably benign	0.00
IGL02236:Lmo7	APN	14	101926088	splice site	probably benign
IGL02318:Lmo7	APN	14	101900066	splice site	probably benign
IGL02345:Lmo7	APN	14	101887473	missense	probably damaging	1.00
IGL02498:Lmo7	APN	14	101807482	missense	probably benign	0.01
IGL02583:Lmo7	APN	14	101933924	utr 3 prime	probably benign
IGL02670:Lmo7	APN	14	101880980	missense	probably damaging	1.00
IGL02694:Lmo7	APN	14	101887170	missense	probably damaging	1.00
IGL03026:Lmo7	APN	14	101929333	utr 3 prime	probably benign
IGL03062:Lmo7	APN	14	101912079	missense	possibly damaging	0.66
IGL03068:Lmo7	APN	14	101875492	unclassified	probably benign
IGL03178:Lmo7	APN	14	101929260	nonsense	probably null
IGL03279:Lmo7	APN	14	101900508	missense	probably benign	0.30
PIT4458001:Lmo7	UTSW	14	101887487	nonsense	probably null
R0029:Lmo7	UTSW	14	101933921	utr 3 prime	probably benign
R0112:Lmo7	UTSW	14	101887193	nonsense	probably null
R0345:Lmo7	UTSW	14	101876877	missense	probably damaging	1.00
R0372:Lmo7	UTSW	14	101918053	splice site	probably benign
R0393:Lmo7	UTSW	14	101900456	missense	probably benign
R0514:Lmo7	UTSW	14	101887173	missense	probably damaging	1.00
R0514:Lmo7	UTSW	14	101896559	missense	probably damaging	1.00
R0526:Lmo7	UTSW	14	101900560	missense	probably damaging	1.00
R0615:Lmo7	UTSW	14	101876859	nonsense	probably null
R0900:Lmo7	UTSW	14	101887188	missense	probably damaging	1.00
R0961:Lmo7	UTSW	14	101794269	missense	probably benign	0.00
R0964:Lmo7	UTSW	14	101920567	splice site	probably benign
R1078:Lmo7	UTSW	14	101920474	splice site	probably benign
R1252:Lmo7	UTSW	14	101900583	missense	probably damaging	1.00
R1527:Lmo7	UTSW	14	101876828	missense	probably damaging	1.00
R1537:Lmo7	UTSW	14	101929264	utr 3 prime	probably benign
R1565:Lmo7	UTSW	14	101887521	missense	probably damaging	0.99
R1637:Lmo7	UTSW	14	101880832	missense	probably damaging	1.00
R1943:Lmo7	UTSW	14	101902302	missense	probably damaging	1.00
R1967:Lmo7	UTSW	14	101900215	missense	probably benign	0.36
R2002:Lmo7	UTSW	14	101887061	missense	probably benign	0.13
R2057:Lmo7	UTSW	14	101887178	missense	probably damaging	1.00
R2131:Lmo7	UTSW	14	101900238	missense	probably damaging	0.99
R2153:Lmo7	UTSW	14	101920515	utr 3 prime	probably benign
R2257:Lmo7	UTSW	14	101900130	missense	probably damaging	1.00
R2355:Lmo7	UTSW	14	101888685	missense	probably damaging	1.00
R2356:Lmo7	UTSW	14	101886945	missense	probably damaging	1.00
R2898:Lmo7	UTSW	14	101876914	missense	possibly damaging	0.93
R3847:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3848:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3849:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3916:Lmo7	UTSW	14	101929342	utr 3 prime	probably benign
R4050:Lmo7	UTSW	14	101902277	nonsense	probably null
R4326:Lmo7	UTSW	14	101900074	missense	possibly damaging	0.93
R4357:Lmo7	UTSW	14	101887655	missense	probably null	1.00
R4571:Lmo7	UTSW	14	101887594	missense	probably damaging	0.96
R4658:Lmo7	UTSW	14	101886957	missense	probably damaging	1.00
R4857:Lmo7	UTSW	14	101887348	splice site	probably null
R5006:Lmo7	UTSW	14	101926237	utr 3 prime	probably benign
R5528:Lmo7	UTSW	14	101902086	missense	probably damaging	1.00
R5588:Lmo7	UTSW	14	101896590	splice site	probably null
R5643:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5644:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5650:Lmo7	UTSW	14	101898674	missense	probably damaging	1.00
R5737:Lmo7	UTSW	14	101887236	missense	probably damaging	1.00
R5832:Lmo7	UTSW	14	101884213	missense	probably damaging	1.00
R5966:Lmo7	UTSW	14	101900502	missense	possibly damaging	0.92
R6026:Lmo7	UTSW	14	101880990	missense	probably benign	0.04
R6072:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R6246:Lmo7	UTSW	14	101918700	missense	probably damaging	1.00
R6335:Lmo7	UTSW	14	101900636	missense	probably damaging	1.00
R6620:Lmo7	UTSW	14	101875452	missense	probably benign	0.29
R6658:Lmo7	UTSW	14	101910845	missense	possibly damaging	0.84
R6917:Lmo7	UTSW	14	101918010	missense	probably damaging	1.00
R7064:Lmo7	UTSW	14	101884179	missense	probably damaging	1.00
R7072:Lmo7	UTSW	14	101898700	critical splice donor site	probably null
R7121:Lmo7	UTSW	14	101887035	missense	probably damaging	1.00
R7136:Lmo7	UTSW	14	101920539	missense	unknown
R7196:Lmo7	UTSW	14	101896500	missense	possibly damaging	0.75
R7228:Lmo7	UTSW	14	101896535	missense	probably damaging	0.99
R7337:Lmo7	UTSW	14	101884204	missense	probably damaging	0.98
R7341:Lmo7	UTSW	14	101885512	missense	probably benign	0.30
R7408:Lmo7	UTSW	14	101880953	missense	probably damaging	1.00
R7432:Lmo7	UTSW	14	101902115	missense	probably benign	0.42
R7470:Lmo7	UTSW	14	101900604	missense	possibly damaging	0.83
R7506:Lmo7	UTSW	14	101919609	missense	unknown
R7559:Lmo7	UTSW	14	101887226	nonsense	probably null
R7565:Lmo7	UTSW	14	101885301	missense	probably damaging	0.98
R7788:Lmo7	UTSW	14	101898576	missense	possibly damaging	0.64
R8095:Lmo7	UTSW	14	101887419	missense	possibly damaging	0.88
R8100:Lmo7	UTSW	14	101900463	missense	probably benign	0.33
R8121:Lmo7	UTSW	14	101926300	missense	unknown
R8308:Lmo7	UTSW	14	101902371	critical splice donor site	probably null
R8371:Lmo7	UTSW	14	101887008	missense	possibly damaging	0.95
R8403:Lmo7	UTSW	14	101902364	missense	probably benign	0.03
R8690:Lmo7	UTSW	14	101931208	missense	unknown
R8778:Lmo7	UTSW	14	101912067	missense	probably damaging	0.98
R8778:Lmo7	UTSW	14	101919219	missense	probably benign	0.24
R8822:Lmo7	UTSW	14	101884174	missense	probably damaging	1.00
R8849:Lmo7	UTSW	14	101926107	missense	unknown
R8923:Lmo7	UTSW	14	101900243	missense	probably benign	0.31
R9006:Lmo7	UTSW	14	101917636	small deletion	probably benign
R9135:Lmo7	UTSW	14	101880861	missense	probably damaging	1.00
R9154:Lmo7	UTSW	14	101885307	missense	probably damaging	0.99
R9178:Lmo7	UTSW	14	101807470	nonsense	probably null
R9375:Lmo7	UTSW	14	101898687	missense	probably damaging	0.99
R9428:Lmo7	UTSW	14	101917640	missense	probably damaging	0.99
R9488:Lmo7	UTSW	14	101885347	missense	possibly damaging	0.85
R9493:Lmo7	UTSW	14	101900471	missense	probably benign	0.01
R9594:Lmo7	UTSW	14	101918700	missense	probably null	0.98
R9674:Lmo7	UTSW	14	101840904	missense	probably damaging	1.00
R9736:Lmo7	UTSW	14	101920493	missense	unknown
X0066:Lmo7	UTSW	14	101887461	missense	probably damaging	1.00
X0067:Lmo7	UTSW	14	101886933	splice site	probably null
Z1176:Lmo7	UTSW	14	101884306	missense	probably damaging	0.99
Z1176:Lmo7	UTSW	14	101919281	missense	probably benign	0.00
Z1176:Lmo7	UTSW	14	101919443	missense	unknown
Z1176:Lmo7	UTSW	14	101929228	missense	unknown
Z1177:Lmo7	UTSW	14	101896518	missense	possibly damaging	0.96
Z1177:Lmo7	UTSW	14	101898557	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGATCAGTTTCTTAGCTGATGC -3'
(R):5'- CGTTGCTCTTCAGGACTGTG -3'

Sequencing Primer
(F):5'- GCATAATCCCATTAGTGTTGTTGC -3'
(R):5'- CTCTTCAGGACTGTGAGAAGC -3'

Posted On

2017-10-10