Incidental Mutation 'R6158:Cpne8'
ID489724
Institutional Source Beutler Lab
Gene Symbol Cpne8
Ensembl Gene ENSMUSG00000052560
Gene Namecopine VIII
Synonyms1200003E11Rik, 1500031E20Rik
MMRRC Submission 044305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6158 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location90487482-90679432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90571988 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 191 (S191A)
Ref Sequence ENSEMBL: ENSMUSP00000067774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064391] [ENSMUST00000088649]
Predicted Effect probably damaging
Transcript: ENSMUST00000064391
AA Change: S191A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067774
Gene: ENSMUSG00000052560
AA Change: S191A

DomainStartEndE-ValueType
C2 37 145 9.76e-10 SMART
C2 170 277 1.06e-10 SMART
low complexity region 284 291 N/A INTRINSIC
VWA 320 518 1.34e-9 SMART
low complexity region 559 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088649
SMART Domains Protein: ENSMUSP00000086024
Gene: ENSMUSG00000052560

DomainStartEndE-ValueType
C2 37 139 8.78e-3 SMART
Meta Mutation Damage Score 0.3517 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.5%
  • 20x: 92.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of the copine family of highly conserved, calcium-dependent phospholipid binding proteins. The encoded protein has two characteristic C2 domains and a VWFA domain and may play a role in membrane trafficking. A related pseudogene is found on chromosome 8. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,170,636 V793A possibly damaging Het
2900092C05Rik A G 7: 12,512,672 T32A probably benign Het
Adprhl1 C T 8: 13,224,977 V594M possibly damaging Het
Ano3 A T 2: 110,665,875 Y845N probably damaging Het
Arhgap24 A T 5: 102,892,912 I575L probably benign Het
Aurka A C 2: 172,363,596 probably null Het
C1qtnf5 A T 9: 44,108,970 probably benign Het
Cacnb2 A G 2: 14,985,601 D454G possibly damaging Het
Ccdc58 T A 16: 36,089,929 V118D probably damaging Het
Chchd5 T C 2: 129,130,517 L87P probably damaging Het
Col7a1 G T 9: 108,964,603 R1377L unknown Het
Dhx30 A T 9: 110,087,030 I671N probably damaging Het
Dnah12 A T 14: 26,773,685 K1423N possibly damaging Het
Dnm3 T C 1: 162,320,987 M272V probably damaging Het
Fat4 A T 3: 38,983,262 S3688C possibly damaging Het
Frmpd1 A T 4: 45,285,401 L1407F probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Gm11565 T A 11: 99,914,918 C45* probably null Het
Gngt1 A T 6: 3,994,311 R30* probably null Het
Htt T C 5: 34,907,086 I2943T possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lmo7 T A 14: 101,900,137 D247E probably benign Het
Mastl G T 2: 23,132,772 N646K possibly damaging Het
Mei4 G T 9: 81,927,576 L237F probably damaging Het
Mettl27 C T 5: 134,940,576 P170S possibly damaging Het
Mgam T A 6: 40,757,714 I896K probably damaging Het
Moxd1 T A 10: 24,284,777 C443S probably damaging Het
Myo18b A T 5: 112,874,172 N451K probably benign Het
Myo7b T C 18: 31,988,549 I768V probably benign Het
Nos1 A C 5: 117,867,574 I120L probably benign Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1095 A G 2: 86,851,515 L61P possibly damaging Het
Olfr1205 T C 2: 88,831,146 F10L probably damaging Het
Olfr150 C T 9: 39,737,076 T87I probably benign Het
Olfr170 C A 16: 19,605,925 V248F probably damaging Het
Olfr344 A T 2: 36,569,116 T173S probably benign Het
Pdzph1 T G 17: 58,973,627 Q553H probably damaging Het
Piwil1 T A 5: 128,747,876 L546* probably null Het
Pla2g4f T C 2: 120,301,071 T724A probably benign Het
Ralgapa2 A T 2: 146,424,676 M660K possibly damaging Het
Rgsl1 T C 1: 153,804,021 D103G possibly damaging Het
Rnf186 A G 4: 138,967,254 D35G probably damaging Het
Rock2 A G 12: 16,954,918 D424G probably benign Het
Scg2 A T 1: 79,435,400 D495E probably damaging Het
Slc39a2 G A 14: 51,894,224 probably null Het
Snrnp48 T A 13: 38,210,236 Y100* probably null Het
Spaca1 A G 4: 34,029,176 M99T probably damaging Het
Specc1 T G 11: 62,118,124 F235L probably damaging Het
St13 A T 15: 81,399,601 probably null Het
Swap70 T A 7: 110,270,023 M341K probably damaging Het
Synj2 A G 17: 5,986,212 D67G probably benign Het
Tmem135 T A 7: 89,156,444 I251F probably benign Het
Tmem87a A T 2: 120,360,103 probably null Het
Tom1l2 C T 11: 60,232,927 D128N probably damaging Het
Tpx2 C A 2: 152,873,104 H82N probably benign Het
Trip12 A T 1: 84,761,012 C738S possibly damaging Het
Ttyh1 A G 7: 4,125,562 T153A probably benign Het
Utrn C T 10: 12,690,822 G1199S probably benign Het
Vmn1r8 T A 6: 57,036,289 N108K probably benign Het
Vmn2r63 T A 7: 42,933,680 D37V probably damaging Het
Vwce C T 19: 10,644,221 R206C possibly damaging Het
Wrn G T 8: 33,319,172 F265L probably damaging Het
Zfp472 T A 17: 32,978,389 C479* probably null Het
Zfp831 A T 2: 174,643,858 T109S possibly damaging Het
Znfx1 G T 2: 167,056,726 Q93K probably benign Het
Other mutations in Cpne8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Cpne8 APN 15 90497058 splice site probably benign
IGL00545:Cpne8 APN 15 90540259 missense probably benign
IGL00951:Cpne8 APN 15 90601893 intron probably benign
IGL01069:Cpne8 APN 15 90615110 critical splice donor site probably null
IGL01294:Cpne8 APN 15 90501445 missense probably damaging 0.96
IGL01720:Cpne8 APN 15 90501500 missense probably benign 0.01
IGL01843:Cpne8 APN 15 90569497 missense probably benign 0.17
PIT4431001:Cpne8 UTSW 15 90551975 missense probably damaging 0.98
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0096:Cpne8 UTSW 15 90499915 missense probably benign 0.24
R0545:Cpne8 UTSW 15 90497075 missense probably damaging 1.00
R0637:Cpne8 UTSW 15 90648621 missense probably damaging 1.00
R0834:Cpne8 UTSW 15 90540259 missense probably benign
R0894:Cpne8 UTSW 15 90649271 missense probably damaging 0.97
R1568:Cpne8 UTSW 15 90619642 missense probably damaging 0.98
R1629:Cpne8 UTSW 15 90571972 missense probably benign 0.03
R1747:Cpne8 UTSW 15 90584915 missense probably benign 0.00
R1761:Cpne8 UTSW 15 90648618 missense probably damaging 1.00
R1884:Cpne8 UTSW 15 90648628 splice site probably benign
R2357:Cpne8 UTSW 15 90619674 missense probably damaging 0.99
R2434:Cpne8 UTSW 15 90509511 missense probably benign 0.07
R4043:Cpne8 UTSW 15 90572001 missense probably damaging 1.00
R4875:Cpne8 UTSW 15 90648568 splice site probably benign
R4969:Cpne8 UTSW 15 90619726 missense probably damaging 1.00
R4981:Cpne8 UTSW 15 90679235 missense probably benign 0.05
R5086:Cpne8 UTSW 15 90648568 splice site probably benign
R5154:Cpne8 UTSW 15 90499918 missense probably benign 0.10
R5199:Cpne8 UTSW 15 90648609 missense probably benign 0.10
R5424:Cpne8 UTSW 15 90516057 missense probably benign 0.00
R5528:Cpne8 UTSW 15 90619690 missense possibly damaging 0.95
R5946:Cpne8 UTSW 15 90488988 makesense probably null
R6977:Cpne8 UTSW 15 90497091 missense probably benign 0.10
R7486:Cpne8 UTSW 15 90515906 critical splice donor site probably null
R7522:Cpne8 UTSW 15 90601819 missense probably benign 0.09
R7684:Cpne8 UTSW 15 90649247 missense probably damaging 1.00
R7726:Cpne8 UTSW 15 90501418 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGTTTGAAATAGAAAATCGCACCC -3'
(R):5'- TCCTTCAATAAGTAATGGCCTCTC -3'

Sequencing Primer
(F):5'- CGCACCCTTCTTTAAAGTATCAAG -3'
(R):5'- ATAAGTAATGGCCTCTCCTCTACAG -3'
Posted On2017-10-10