Incidental Mutation 'R6158:Pdzph1'
ID 489729
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 044305-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R6158 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 59280622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 553 (Q553H)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably damaging
Transcript: ENSMUST00000025064
AA Change: Q553H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: Q553H

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.5%
  • 20x: 92.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,217,410 (GRCm39) V793A possibly damaging Het
2900092C05Rik A G 7: 12,246,599 (GRCm39) T32A probably benign Het
Adprhl1 C T 8: 13,274,977 (GRCm39) V594M possibly damaging Het
Ano3 A T 2: 110,496,220 (GRCm39) Y845N probably damaging Het
Arhgap24 A T 5: 103,040,778 (GRCm39) I575L probably benign Het
Aurka A C 2: 172,205,516 (GRCm39) probably null Het
C1qtnf5 A T 9: 44,020,267 (GRCm39) probably benign Het
Cacnb2 A G 2: 14,990,412 (GRCm39) D454G possibly damaging Het
Chchd5 T C 2: 128,972,437 (GRCm39) L87P probably damaging Het
Col7a1 G T 9: 108,793,671 (GRCm39) R1377L unknown Het
Cpne8 A C 15: 90,456,191 (GRCm39) S191A probably damaging Het
Dhx30 A T 9: 109,916,098 (GRCm39) I671N probably damaging Het
Dnah12 A T 14: 26,495,642 (GRCm39) K1423N possibly damaging Het
Dnm3 T C 1: 162,148,556 (GRCm39) M272V probably damaging Het
Fat4 A T 3: 39,037,411 (GRCm39) S3688C possibly damaging Het
Frmpd1 A T 4: 45,285,401 (GRCm39) L1407F probably damaging Het
Fry T C 5: 150,378,037 (GRCm39) S410P probably damaging Het
Gm11565 T A 11: 99,805,744 (GRCm39) C45* probably null Het
Gngt1 A T 6: 3,994,311 (GRCm39) R30* probably null Het
Htt T C 5: 35,064,430 (GRCm39) I2943T possibly damaging Het
Kl T A 5: 150,912,318 (GRCm39) M689K possibly damaging Het
Lmo7 T A 14: 102,137,573 (GRCm39) D247E probably benign Het
Mastl G T 2: 23,022,784 (GRCm39) N646K possibly damaging Het
Mei4 G T 9: 81,809,629 (GRCm39) L237F probably damaging Het
Mettl27 C T 5: 134,969,430 (GRCm39) P170S possibly damaging Het
Mgam T A 6: 40,734,648 (GRCm39) I896K probably damaging Het
Mix23 T A 16: 35,910,299 (GRCm39) V118D probably damaging Het
Moxd1 T A 10: 24,160,675 (GRCm39) C443S probably damaging Het
Myo18b A T 5: 113,022,038 (GRCm39) N451K probably benign Het
Myo7b T C 18: 32,121,602 (GRCm39) I768V probably benign Het
Nos1 A C 5: 118,005,639 (GRCm39) I120L probably benign Het
Nsd1 T C 13: 55,393,434 (GRCm39) V345A probably benign Het
Or1j15 A T 2: 36,459,128 (GRCm39) T173S probably benign Het
Or2aj5 C A 16: 19,424,675 (GRCm39) V248F probably damaging Het
Or4c11c T C 2: 88,661,490 (GRCm39) F10L probably damaging Het
Or5t15 A G 2: 86,681,859 (GRCm39) L61P possibly damaging Het
Or8g50 C T 9: 39,648,372 (GRCm39) T87I probably benign Het
Piwil1 T A 5: 128,824,940 (GRCm39) L546* probably null Het
Pla2g4f T C 2: 120,131,552 (GRCm39) T724A probably benign Het
Ralgapa2 A T 2: 146,266,596 (GRCm39) M660K possibly damaging Het
Rgsl1 T C 1: 153,679,767 (GRCm39) D103G possibly damaging Het
Rnf186 A G 4: 138,694,565 (GRCm39) D35G probably damaging Het
Rock2 A G 12: 17,004,919 (GRCm39) D424G probably benign Het
Scg2 A T 1: 79,413,117 (GRCm39) D495E probably damaging Het
Slc39a2 G A 14: 52,131,681 (GRCm39) probably null Het
Snrnp48 T A 13: 38,394,212 (GRCm39) Y100* probably null Het
Spaca1 A G 4: 34,029,176 (GRCm39) M99T probably damaging Het
Specc1 T G 11: 62,008,950 (GRCm39) F235L probably damaging Het
St13 A T 15: 81,283,802 (GRCm39) probably null Het
Swap70 T A 7: 109,869,230 (GRCm39) M341K probably damaging Het
Synj2 A G 17: 6,036,487 (GRCm39) D67G probably benign Het
Tmem135 T A 7: 88,805,652 (GRCm39) I251F probably benign Het
Tmem87a A T 2: 120,190,584 (GRCm39) probably null Het
Tom1l2 C T 11: 60,123,753 (GRCm39) D128N probably damaging Het
Tpx2 C A 2: 152,715,024 (GRCm39) H82N probably benign Het
Trip12 A T 1: 84,738,733 (GRCm39) C738S possibly damaging Het
Ttyh1 A G 7: 4,128,561 (GRCm39) T153A probably benign Het
Utrn C T 10: 12,566,566 (GRCm39) G1199S probably benign Het
Vmn1r8 T A 6: 57,013,274 (GRCm39) N108K probably benign Het
Vmn2r63 T A 7: 42,583,104 (GRCm39) D37V probably damaging Het
Vwce C T 19: 10,621,585 (GRCm39) R206C possibly damaging Het
Wrn G T 8: 33,809,200 (GRCm39) F265L probably damaging Het
Zfp472 T A 17: 33,197,363 (GRCm39) C479* probably null Het
Zfp831 A T 2: 174,485,651 (GRCm39) T109S possibly damaging Het
Znfx1 G T 2: 166,898,646 (GRCm39) Q93K probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTCCATTCTGCTGAGG -3'
(R):5'- AGGACATGAGAGCTCAAATTCCC -3'

Sequencing Primer
(F):5'- ATTCTGCTGAGGCCTGCC -3'
(R):5'- TCCTGTCAGTGAACAAGCTG -3'
Posted On 2017-10-10