Incidental Mutation 'R6159:Chrnd'
ID489733
Institutional Source Beutler Lab
Gene Symbol Chrnd
Ensembl Gene ENSMUSG00000026251
Gene Namecholinergic receptor, nicotinic, delta polypeptide
SynonymsAcrd, Achr-4
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6159 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87190607-87200070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87191090 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 56 (D56E)
Ref Sequence ENSEMBL: ENSMUSP00000072983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044533] [ENSMUST00000073252] [ENSMUST00000186373]
Predicted Effect probably benign
Transcript: ENSMUST00000044533
SMART Domains Protein: ENSMUSP00000138773
Gene: ENSMUSG00000036480

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Tryp_SPc 58 103 1e-5 BLAST
Tryp_SPc 108 336 1.17e-84 SMART
Blast:Tryp_SPc 340 385 4e-9 BLAST
low complexity region 386 407 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Blast:Tryp_SPc 432 499 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073252
AA Change: D56E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072983
Gene: ENSMUSG00000026251
AA Change: D56E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 28 249 4.4e-70 PFAM
Pfam:Neur_chan_memb 256 492 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186373
SMART Domains Protein: ENSMUSP00000139537
Gene: ENSMUSG00000026251

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 140 4.2e-40 PFAM
Pfam:Neur_chan_memb 147 383 6.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189970
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene encodes the delta subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The delta subunit together with the alpha subunit forms the ligand-binding site. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm14496 A G 2: 181,996,257 T375A probably benign Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Gnrhr G T 5: 86,182,357 T268K probably damaging Het
Htt T C 5: 34,804,676 V335A probably benign Het
Klhl20 A T 1: 161,105,467 L257H probably damaging Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Olfr1505 C T 19: 13,919,740 T240I probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rasal1 T C 5: 120,659,608 L135P probably damaging Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Sntb1 A G 15: 55,676,302 probably null Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Chrnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Chrnd APN 1 87192927 nonsense probably null
IGL00754:Chrnd APN 1 87195784 missense probably benign 0.00
IGL00765:Chrnd APN 1 87195709 missense probably damaging 1.00
IGL01666:Chrnd APN 1 87198736 missense possibly damaging 0.55
IGL03179:Chrnd APN 1 87195780 missense probably damaging 1.00
R0071:Chrnd UTSW 1 87192837 splice site probably benign
R0071:Chrnd UTSW 1 87192837 splice site probably benign
R0531:Chrnd UTSW 1 87194819 missense probably damaging 1.00
R1164:Chrnd UTSW 1 87192545 missense probably benign
R1386:Chrnd UTSW 1 87192590 missense probably damaging 0.97
R1768:Chrnd UTSW 1 87194928 missense probably benign
R1780:Chrnd UTSW 1 87192548 missense possibly damaging 0.52
R2336:Chrnd UTSW 1 87194893 missense probably damaging 1.00
R4093:Chrnd UTSW 1 87191007 nonsense probably null
R4424:Chrnd UTSW 1 87195790 missense probably benign 0.38
R4467:Chrnd UTSW 1 87197377 missense probably damaging 0.99
R4828:Chrnd UTSW 1 87191571 splice site probably benign
R5701:Chrnd UTSW 1 87197658 missense possibly damaging 0.77
R5895:Chrnd UTSW 1 87195667 intron probably null
R6321:Chrnd UTSW 1 87192229 missense probably damaging 1.00
R6927:Chrnd UTSW 1 87198712 missense probably damaging 1.00
R7189:Chrnd UTSW 1 87191058 missense probably damaging 1.00
R7242:Chrnd UTSW 1 87197479 missense probably damaging 0.99
R7420:Chrnd UTSW 1 87194821 missense possibly damaging 0.89
R7996:Chrnd UTSW 1 87191106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTAAGGATGACATAACCCC -3'
(R):5'- ATAGCTTGACAGTGGCAGGC -3'

Sequencing Primer
(F):5'- GGATGACATAACCCCCTTCCTGG -3'
(R):5'- CAGGCAGAGCTGATGGC -3'
Posted On2017-10-10