Incidental Mutation 'R6159:Klhl20'
ID489735
Institutional Source Beutler Lab
Gene Symbol Klhl20
Ensembl Gene ENSMUSG00000026705
Gene Namekelch-like 20
SynonymsD930050H05Rik
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6159 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location161088375-161131511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161105467 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 257 (L257H)
Ref Sequence ENSEMBL: ENSMUSP00000114044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467]
Predicted Effect probably damaging
Transcript: ENSMUST00000111611
AA Change: L257H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: L257H

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117467
AA Change: L257H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: L257H

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192890
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Chrnd T A 1: 87,191,090 D56E probably benign Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm14496 A G 2: 181,996,257 T375A probably benign Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Gnrhr G T 5: 86,182,357 T268K probably damaging Het
Htt T C 5: 34,804,676 V335A probably benign Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Olfr1505 C T 19: 13,919,740 T240I probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rasal1 T C 5: 120,659,608 L135P probably damaging Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Sntb1 A G 15: 55,676,302 probably null Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Klhl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Klhl20 APN 1 161109755 missense probably benign 0.00
IGL00903:Klhl20 APN 1 161090506 missense probably benign 0.00
IGL01574:Klhl20 APN 1 161093726 missense probably damaging 1.00
IGL01721:Klhl20 APN 1 161095587 missense probably damaging 1.00
IGL01933:Klhl20 APN 1 161106787 missense probably damaging 1.00
IGL02187:Klhl20 APN 1 161109710 missense probably benign 0.05
IGL02634:Klhl20 APN 1 161098365 missense probably damaging 0.98
IGL02691:Klhl20 APN 1 161106874 splice site probably benign
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0639:Klhl20 UTSW 1 161093711 missense probably damaging 1.00
R1730:Klhl20 UTSW 1 161102990 missense possibly damaging 0.82
R1856:Klhl20 UTSW 1 161106742 missense probably benign 0.00
R2016:Klhl20 UTSW 1 161103038 missense probably damaging 0.98
R2901:Klhl20 UTSW 1 161109552 nonsense probably null
R4822:Klhl20 UTSW 1 161093763 nonsense probably null
R4830:Klhl20 UTSW 1 161098376 missense probably benign 0.00
R4894:Klhl20 UTSW 1 161109532 missense possibly damaging 0.76
R4981:Klhl20 UTSW 1 161103005 missense possibly damaging 0.48
R5018:Klhl20 UTSW 1 161101586 missense probably damaging 0.98
R5023:Klhl20 UTSW 1 161109220 critical splice donor site probably null
R5108:Klhl20 UTSW 1 161099250 missense probably damaging 0.99
R5216:Klhl20 UTSW 1 161093679 critical splice donor site probably null
R5659:Klhl20 UTSW 1 161090470 missense probably damaging 1.00
R6836:Klhl20 UTSW 1 161105406 missense probably benign 0.18
R6914:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6915:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6920:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R7706:Klhl20 UTSW 1 161109257 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATACTGGGAATTCAGCCCTCTC -3'
(R):5'- GCATTTTAAAGTGATAGGAGCATGC -3'

Sequencing Primer
(F):5'- TCTCTTGACCCTAGCCCACAAG -3'
(R):5'- AGGAGCATGCTTTAGTTTTGTAAC -3'
Posted On2017-10-10