Incidental Mutation 'R6159:Cabs1'
ID489746
Institutional Source Beutler Lab
Gene Symbol Cabs1
Ensembl Gene ENSMUSG00000007907
Gene Namecalcium binding protein, spermatid specific 1
Synonyms4931407G18Rik
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6159 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location87979439-87981544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87979754 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 88 (T88I)
Ref Sequence ENSEMBL: ENSMUSP00000008051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008051] [ENSMUST00000187738]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008051
AA Change: T88I

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000008051
Gene: ENSMUSG00000007907
AA Change: T88I

DomainStartEndE-ValueType
Pfam:CABS1 1 391 6.1e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Meta Mutation Damage Score 0.4121 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Chrnd T A 1: 87,191,090 D56E probably benign Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm14496 A G 2: 181,996,257 T375A probably benign Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Gnrhr G T 5: 86,182,357 T268K probably damaging Het
Htt T C 5: 34,804,676 V335A probably benign Het
Klhl20 A T 1: 161,105,467 L257H probably damaging Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Olfr1505 C T 19: 13,919,740 T240I probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rasal1 T C 5: 120,659,608 L135P probably damaging Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Sntb1 A G 15: 55,676,302 probably null Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Cabs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Cabs1 APN 5 87980010 missense possibly damaging 0.64
IGL01999:Cabs1 APN 5 87979928 missense possibly damaging 0.95
IGL02174:Cabs1 APN 5 87980480 missense probably benign
IGL02930:Cabs1 APN 5 87979886 missense probably damaging 0.99
R0126:Cabs1 UTSW 5 87980195 missense probably damaging 1.00
R1590:Cabs1 UTSW 5 87979631 missense probably damaging 0.99
R1893:Cabs1 UTSW 5 87980035 missense probably benign 0.00
R2257:Cabs1 UTSW 5 87980215 missense probably damaging 0.99
R2364:Cabs1 UTSW 5 87980233 missense probably benign 0.00
R4078:Cabs1 UTSW 5 87980302 missense probably damaging 0.99
R4914:Cabs1 UTSW 5 87980437 missense probably damaging 1.00
R5318:Cabs1 UTSW 5 87980566 missense possibly damaging 0.95
R5356:Cabs1 UTSW 5 87979633 missense probably benign
R6152:Cabs1 UTSW 5 87979754 missense possibly damaging 0.95
R6154:Cabs1 UTSW 5 87979754 missense possibly damaging 0.95
R6169:Cabs1 UTSW 5 87979754 missense possibly damaging 0.95
R6177:Cabs1 UTSW 5 87979754 missense possibly damaging 0.95
R6505:Cabs1 UTSW 5 87980663 missense possibly damaging 0.85
R7726:Cabs1 UTSW 5 87980286 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGGCTGACAACACCATTC -3'
(R):5'- TGTGCCAGAGAACTCAGTAGTG -3'

Sequencing Primer
(F):5'- GGGCTGACAACACCATTCCTAAATC -3'
(R):5'- CCAGAGAACTCAGTAGTGGGTAC -3'
Posted On2017-10-10