Mutagenetix > Incidental Mutation

Incidental Mutation 'R6159:Taf2'

489775

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

044306-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6159 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55063044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 170 (M170K)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041733
AA Change: M170K

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: M170K

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226864

Meta Mutation Damage Score

0.1614

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 94.2%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahcyl2	A	C	6: 29,908,458	N609T	possibly damaging	Het
Ankzf1	G	A	1: 75,194,244	C98Y	probably damaging	Het
Atg101	T	A	15: 101,290,638	M208K	possibly damaging	Het
Baiap2l2	A	G	15: 79,259,730	I388T	probably benign	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Chrnd	T	A	1: 87,191,090	D56E	probably benign	Het
Col28a1	A	T	6: 8,162,247		probably null	Het
Col4a1	G	T	8: 11,220,007	P899Q	probably damaging	Het
Cts3	C	A	13: 61,566,841	A217S	probably damaging	Het
Dab2	A	G	15: 6,436,460	N495S	possibly damaging	Het
Dnah2	T	A	11: 69,458,542	I2423F	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dock6	T	C	9: 21,821,745	H1053R	probably benign	Het
Fam184a	G	A	10: 53,698,773	L191F	probably damaging	Het
Fip1l1	C	T	5: 74,591,947	R472W	probably damaging	Het
Gbp2	T	C	3: 142,632,257	F378S	probably damaging	Het
Ggt1	A	T	10: 75,584,965	E388V	probably damaging	Het
Gm14496	A	G	2: 181,996,257	T375A	probably benign	Het
Gm2035	G	A	12: 87,919,751	A36V	probably damaging	Het
Gm43302	A	G	5: 105,289,028	S71P	probably benign	Het
Gnrhr	G	T	5: 86,182,357	T268K	probably damaging	Het
Htt	T	C	5: 34,804,676	V335A	probably benign	Het
Klhl20	A	T	1: 161,105,467	L257H	probably damaging	Het
Lrrc29	T	C	8: 105,323,293	Y33C	probably damaging	Het
Med27	C	A	2: 29,524,364		probably null	Het
Muc5ac	T	A	7: 141,815,586	C2433S	possibly damaging	Het
Nasp	A	G	4: 116,603,889		probably null	Het
Nipal2	A	C	15: 34,600,026	V215G	probably damaging	Het
Olfr121	A	T	17: 37,752,147	I98F	probably damaging	Het
Olfr1505	C	T	19: 13,919,740	T240I	probably damaging	Het
Oxct2b	G	A	4: 123,117,451	R388H	probably damaging	Het
Pbrm1	A	G	14: 31,052,283	I469V	possibly damaging	Het
Phyhip	A	G	14: 70,466,854	H171R	possibly damaging	Het
Pigs	C	T	11: 78,328,500	T9M	probably benign	Het
Plek	T	C	11: 16,985,539	D256G	probably damaging	Het
Prss50	T	C	9: 110,864,303	V369A	probably benign	Het
Psmc5	A	G	11: 106,261,262	K82E	possibly damaging	Het
Qrsl1	A	T	10: 43,882,193	F301L	probably benign	Het
Rasal1	T	C	5: 120,659,608	L135P	probably damaging	Het
Rbm47	A	G	5: 66,026,816	V148A	probably damaging	Het
Scyl1	T	A	19: 5,764,757	D381V	probably benign	Het
Selplg	G	T	5: 113,819,101	D381E	probably benign	Het
Sh3rf2	C	A	18: 42,156,135	Q674K	probably damaging	Het
Sned1	A	G	1: 93,282,937	T987A	probably benign	Het
Sntb1	A	G	15: 55,676,302		probably null	Het
Synj2	A	T	17: 5,986,052	I14F	probably damaging	Het
Tg	A	G	15: 66,735,247	E211G	possibly damaging	Het
Thnsl1	G	T	2: 21,212,205	E257*	probably null	Het
Tlr4	A	G	4: 66,839,833	R288G	possibly damaging	Het
Trbc1	T	C	6: 41,538,451		probably benign	Het
Trim37	G	A	11: 87,216,548		probably null	Het
Txnrd3	T	C	6: 89,663,194		probably null	Het
Tyk2	C	A	9: 21,110,504	Q875H	probably damaging	Het
Vmn2r55	A	G	7: 12,651,771	Y761H	probably damaging	Het
Zswim5	T	C	4: 116,979,679	L720P	probably damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCCTGTGAGAAGGAACACTC -3'
(R):5'- ATATGATGCTCCGGCTGTG -3'

Sequencing Primer
(F):5'- CTCAGAAGCAGCTTAGGGTTG -3'
(R):5'- CTCCGGCTGTGGGTCTCATG -3'

Posted On

2017-10-10