Mutagenetix > Incidental Mutation

Incidental Mutation 'R6159:Sntb1'

489776

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

044306-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R6159 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 55676302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769] [ENSMUST00000039769]

AlphaFold

Q99L88

Predicted Effect

probably null
Transcript: ENSMUST00000039769

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000039769

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 94.2%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahcyl2	A	C	6: 29,908,458	N609T	possibly damaging	Het
Ankzf1	G	A	1: 75,194,244	C98Y	probably damaging	Het
Atg101	T	A	15: 101,290,638	M208K	possibly damaging	Het
Baiap2l2	A	G	15: 79,259,730	I388T	probably benign	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Chrnd	T	A	1: 87,191,090	D56E	probably benign	Het
Col28a1	A	T	6: 8,162,247		probably null	Het
Col4a1	G	T	8: 11,220,007	P899Q	probably damaging	Het
Cts3	C	A	13: 61,566,841	A217S	probably damaging	Het
Dab2	A	G	15: 6,436,460	N495S	possibly damaging	Het
Dnah2	T	A	11: 69,458,542	I2423F	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dock6	T	C	9: 21,821,745	H1053R	probably benign	Het
Fam184a	G	A	10: 53,698,773	L191F	probably damaging	Het
Fip1l1	C	T	5: 74,591,947	R472W	probably damaging	Het
Gbp2	T	C	3: 142,632,257	F378S	probably damaging	Het
Ggt1	A	T	10: 75,584,965	E388V	probably damaging	Het
Gm14496	A	G	2: 181,996,257	T375A	probably benign	Het
Gm2035	G	A	12: 87,919,751	A36V	probably damaging	Het
Gm43302	A	G	5: 105,289,028	S71P	probably benign	Het
Gnrhr	G	T	5: 86,182,357	T268K	probably damaging	Het
Htt	T	C	5: 34,804,676	V335A	probably benign	Het
Klhl20	A	T	1: 161,105,467	L257H	probably damaging	Het
Lrrc29	T	C	8: 105,323,293	Y33C	probably damaging	Het
Med27	C	A	2: 29,524,364		probably null	Het
Muc5ac	T	A	7: 141,815,586	C2433S	possibly damaging	Het
Nasp	A	G	4: 116,603,889		probably null	Het
Nipal2	A	C	15: 34,600,026	V215G	probably damaging	Het
Olfr121	A	T	17: 37,752,147	I98F	probably damaging	Het
Olfr1505	C	T	19: 13,919,740	T240I	probably damaging	Het
Oxct2b	G	A	4: 123,117,451	R388H	probably damaging	Het
Pbrm1	A	G	14: 31,052,283	I469V	possibly damaging	Het
Phyhip	A	G	14: 70,466,854	H171R	possibly damaging	Het
Pigs	C	T	11: 78,328,500	T9M	probably benign	Het
Plek	T	C	11: 16,985,539	D256G	probably damaging	Het
Prss50	T	C	9: 110,864,303	V369A	probably benign	Het
Psmc5	A	G	11: 106,261,262	K82E	possibly damaging	Het
Qrsl1	A	T	10: 43,882,193	F301L	probably benign	Het
Rasal1	T	C	5: 120,659,608	L135P	probably damaging	Het
Rbm47	A	G	5: 66,026,816	V148A	probably damaging	Het
Scyl1	T	A	19: 5,764,757	D381V	probably benign	Het
Selplg	G	T	5: 113,819,101	D381E	probably benign	Het
Sh3rf2	C	A	18: 42,156,135	Q674K	probably damaging	Het
Sned1	A	G	1: 93,282,937	T987A	probably benign	Het
Synj2	A	T	17: 5,986,052	I14F	probably damaging	Het
Taf2	A	T	15: 55,063,044	M170K	possibly damaging	Het
Tg	A	G	15: 66,735,247	E211G	possibly damaging	Het
Thnsl1	G	T	2: 21,212,205	E257*	probably null	Het
Tlr4	A	G	4: 66,839,833	R288G	possibly damaging	Het
Trbc1	T	C	6: 41,538,451		probably benign	Het
Trim37	G	A	11: 87,216,548		probably null	Het
Txnrd3	T	C	6: 89,663,194		probably null	Het
Tyk2	C	A	9: 21,110,504	Q875H	probably damaging	Het
Vmn2r55	A	G	7: 12,651,771	Y761H	probably damaging	Het
Zswim5	T	C	4: 116,979,679	L720P	probably damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37
R9280:Sntb1	UTSW	15	55906375	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCCTAAGTTCCAGGGAGTCC -3'
(R):5'- CTTATAGAAGGGTTGCTGATGTCTC -3'

Sequencing Primer
(F):5'- TCCTGGAACCAAGATGGCGAC -3'
(R):5'- AGAAGGGTTGCTGATGTCTCTTTTC -3'

Posted On

2017-10-10