Incidental Mutation 'R6159:Sntb1'
ID489776
Institutional Source Beutler Lab
Gene Symbol Sntb1
Ensembl Gene ENSMUSG00000060429
Gene Namesyntrophin, basic 1
Synonyms59-1 DAP, beta1-Syntrophin
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6159 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location55636388-55906949 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 55676302 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039769] [ENSMUST00000039769]
Predicted Effect probably null
Transcript: ENSMUST00000039769
SMART Domains Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429

DomainStartEndE-ValueType
PH 19 299 5.14e0 SMART
PDZ 120 194 4.5e-17 SMART
PH 322 434 2.81e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039769
SMART Domains Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429

DomainStartEndE-ValueType
PH 19 299 5.14e0 SMART
PDZ 120 194 4.5e-17 SMART
PH 322 434 2.81e-8 SMART
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Chrnd T A 1: 87,191,090 D56E probably benign Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm14496 A G 2: 181,996,257 T375A probably benign Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Gnrhr G T 5: 86,182,357 T268K probably damaging Het
Htt T C 5: 34,804,676 V335A probably benign Het
Klhl20 A T 1: 161,105,467 L257H probably damaging Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Olfr1505 C T 19: 13,919,740 T240I probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rasal1 T C 5: 120,659,608 L135P probably damaging Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Sntb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Sntb1 APN 15 55648039 missense possibly damaging 0.93
IGL02732:Sntb1 APN 15 55792200 missense possibly damaging 0.62
IGL02965:Sntb1 APN 15 55642685 nonsense probably null
IGL03084:Sntb1 APN 15 55792091 missense probably damaging 0.99
IGL03286:Sntb1 APN 15 55792046 missense possibly damaging 0.59
R0117:Sntb1 UTSW 15 55906353 missense probably benign
R0178:Sntb1 UTSW 15 55906144 missense probably damaging 0.98
R0465:Sntb1 UTSW 15 55749276 missense probably benign 0.02
R0626:Sntb1 UTSW 15 55642783 missense probably benign 0.20
R0726:Sntb1 UTSW 15 55676356 missense probably benign
R1125:Sntb1 UTSW 15 55749280 missense probably benign
R1443:Sntb1 UTSW 15 55647955 missense probably damaging 1.00
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R2208:Sntb1 UTSW 15 55906318 missense possibly damaging 0.79
R2426:Sntb1 UTSW 15 55906179 missense probably damaging 1.00
R3721:Sntb1 UTSW 15 55642818 missense probably benign 0.10
R4370:Sntb1 UTSW 15 55792091 missense probably damaging 0.99
R4706:Sntb1 UTSW 15 55749274 missense probably benign 0.09
R4883:Sntb1 UTSW 15 55642802 nonsense probably null
R5223:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5242:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5270:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5313:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5314:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5316:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5336:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5337:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5396:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5398:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5427:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5428:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5429:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5431:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5594:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5658:Sntb1 UTSW 15 55792076 missense probably damaging 1.00
R5665:Sntb1 UTSW 15 55792139 missense probably benign 0.00
R6147:Sntb1 UTSW 15 55648010 missense probably benign
R6883:Sntb1 UTSW 15 55906323 missense probably benign 0.38
R7008:Sntb1 UTSW 15 55792072 nonsense probably null
R7168:Sntb1 UTSW 15 55791265 missense probably benign 0.00
R7511:Sntb1 UTSW 15 55647951 missense possibly damaging 0.71
R7600:Sntb1 UTSW 15 55792188 missense possibly damaging 0.82
R8242:Sntb1 UTSW 15 55792233 missense possibly damaging 0.95
R8804:Sntb1 UTSW 15 55792127 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTCCTAAGTTCCAGGGAGTCC -3'
(R):5'- CTTATAGAAGGGTTGCTGATGTCTC -3'

Sequencing Primer
(F):5'- TCCTGGAACCAAGATGGCGAC -3'
(R):5'- AGAAGGGTTGCTGATGTCTCTTTTC -3'
Posted On2017-10-10