Incidental Mutation 'R6159:Olfr1505'
ID489784
Institutional Source Beutler Lab
Gene Symbol Olfr1505
Ensembl Gene ENSMUSG00000062314
Gene Nameolfactory receptor 1505
SynonymsMOR211-4P, GA_x6K02T2RE5P-4250267-4251217, MOR211-10_i
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6159 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13913530-13921866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13919740 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 240 (T240I)
Ref Sequence ENSEMBL: ENSMUSP00000148945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081520] [ENSMUST00000216623] [ENSMUST00000216835]
Predicted Effect probably damaging
Transcript: ENSMUST00000081520
AA Change: T240I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080235
Gene: ENSMUSG00000062314
AA Change: T240I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-43 PFAM
Pfam:7tm_1 41 290 2.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216623
AA Change: T240I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216835
AA Change: T240I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5997 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Chrnd T A 1: 87,191,090 D56E probably benign Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm14496 A G 2: 181,996,257 T375A probably benign Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Gnrhr G T 5: 86,182,357 T268K probably damaging Het
Htt T C 5: 34,804,676 V335A probably benign Het
Klhl20 A T 1: 161,105,467 L257H probably damaging Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rasal1 T C 5: 120,659,608 L135P probably damaging Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Sntb1 A G 15: 55,676,302 probably null Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Olfr1505
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr1505 APN 19 13919528 nonsense probably null
IGL03388:Olfr1505 APN 19 13919620 missense probably damaging 0.99
R0143:Olfr1505 UTSW 19 13919250 missense probably damaging 1.00
R0326:Olfr1505 UTSW 19 13919509 missense probably benign 0.13
R0602:Olfr1505 UTSW 19 13919781 missense probably benign 0.13
R0624:Olfr1505 UTSW 19 13919444 missense probably damaging 0.99
R0947:Olfr1505 UTSW 19 13919171 missense probably benign 0.00
R1472:Olfr1505 UTSW 19 13919844 missense probably damaging 1.00
R1691:Olfr1505 UTSW 19 13919419 missense probably benign 0.00
R2991:Olfr1505 UTSW 19 13919311 missense probably damaging 1.00
R4296:Olfr1505 UTSW 19 13919353 missense probably damaging 1.00
R4688:Olfr1505 UTSW 19 13919241 missense probably benign 0.01
R4814:Olfr1505 UTSW 19 13919453 missense possibly damaging 0.50
R4823:Olfr1505 UTSW 19 13919658 missense probably benign 0.02
R5038:Olfr1505 UTSW 19 13919458 missense possibly damaging 0.58
R5243:Olfr1505 UTSW 19 13919661 missense probably damaging 1.00
R5323:Olfr1505 UTSW 19 13919616 missense possibly damaging 0.95
R5542:Olfr1505 UTSW 19 13919047 missense probably benign 0.04
R5918:Olfr1505 UTSW 19 13919775 missense probably damaging 1.00
R6011:Olfr1505 UTSW 19 13919157 missense probably benign 0.00
R7535:Olfr1505 UTSW 19 13919085 missense probably benign
R8262:Olfr1505 UTSW 19 13919862 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCTGCGTACCACATGCACC -3'
(R):5'- AATGCAGCCTTGACATCCTTG -3'

Sequencing Primer
(F):5'- CTCTCTCCTTCTGTGAAAATAATCAG -3'
(R):5'- CCTTGTTTCTTAGGCTGTAGACAAG -3'
Posted On2017-10-10