Incidental Mutation 'R6160:Clip1'
ID489798
Institutional Source Beutler Lab
Gene Symbol Clip1
Ensembl Gene ENSMUSG00000049550
Gene NameCAP-GLY domain containing linker protein 1
SynonymsClip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6160 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123577795-123684618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123613541 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 726 (K726E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]
Predicted Effect probably benign
Transcript: ENSMUST00000031382
SMART Domains Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.28e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.28e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 451 N/A INTRINSIC
coiled coil region 474 535 N/A INTRINSIC
coiled coil region 581 620 N/A INTRINSIC
coiled coil region 652 1352 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
Pfam:CLIP1_ZNF 1375 1392 5.8e-9 PFAM
ZnF_C2HC 1417 1433 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063905
SMART Domains Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 3.3e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 3.3e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1075 N/A INTRINSIC
coiled coil region 1115 1235 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
ZnF_C2HC 1300 1316 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111561
SMART Domains Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 1.93e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 1.93e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1341 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
ZnF_C2HC 1406 1422 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111564
SMART Domains Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.5e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.5e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1230 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
ZnF_C2HC 1295 1311 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111566
SMART Domains Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 2e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1306 N/A INTRINSIC
low complexity region 1316 1327 N/A INTRINSIC
ZnF_C2HC 1371 1387 1.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133545
Predicted Effect probably benign
Transcript: ENSMUST00000137363
SMART Domains Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
CAP_GLY 2 31 2.59e0 SMART
low complexity region 39 57 N/A INTRINSIC
low complexity region 58 84 N/A INTRINSIC
coiled coil region 101 276 N/A INTRINSIC
coiled coil region 322 361 N/A INTRINSIC
coiled coil region 393 980 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Pfam:CLIP1_ZNF 1004 1021 4.2e-9 PFAM
ZnF_C2HC 1046 1062 1.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137602
Predicted Effect probably benign
Transcript: ENSMUST00000144121
SMART Domains Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
CAP_GLY 37 102 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149410
SMART Domains Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
CAP_GLY 60 125 1.05e-31 SMART
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 334 458 N/A INTRINSIC
coiled coil region 504 543 N/A INTRINSIC
coiled coil region 575 827 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154672
AA Change: K726E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: K726E

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 165 176 N/A INTRINSIC
internal_repeat_1 352 375 1.56e-8 PROSPERO
internal_repeat_3 358 377 5.32e-6 PROSPERO
internal_repeat_1 450 473 1.56e-8 PROSPERO
internal_repeat_3 544 563 5.32e-6 PROSPERO
internal_repeat_2 553 575 2.88e-7 PROSPERO
low complexity region 735 744 N/A INTRINSIC
internal_repeat_2 781 803 2.88e-7 PROSPERO
low complexity region 819 830 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1164 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Clip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Clip1 APN 5 123603654 missense possibly damaging 0.94
IGL01067:Clip1 APN 5 123630804 missense probably damaging 0.99
IGL01524:Clip1 APN 5 123579379 missense probably damaging 1.00
IGL01632:Clip1 APN 5 123617496 missense probably damaging 1.00
IGL01798:Clip1 APN 5 123583549 missense probably damaging 1.00
IGL01874:Clip1 APN 5 123603666 missense possibly damaging 0.50
IGL01908:Clip1 APN 5 123623207 splice site probably benign
IGL02120:Clip1 APN 5 123647883 missense probably damaging 1.00
IGL02309:Clip1 APN 5 123617700 missense probably damaging 0.99
IGL02555:Clip1 APN 5 123621794 critical splice donor site probably null
IGL03027:Clip1 APN 5 123621856 missense probably benign 0.43
IGL03336:Clip1 APN 5 123653570 nonsense probably null
IGL03365:Clip1 APN 5 123583586 missense probably damaging 1.00
IGL02802:Clip1 UTSW 5 123631123 missense probably damaging 1.00
PIT4812001:Clip1 UTSW 5 123630675 missense probably benign 0.08
R0254:Clip1 UTSW 5 123617332 splice site probably benign
R0401:Clip1 UTSW 5 123653789 missense probably damaging 1.00
R0530:Clip1 UTSW 5 123640531 missense probably damaging 1.00
R0744:Clip1 UTSW 5 123630721 missense probably benign 0.05
R0833:Clip1 UTSW 5 123630721 missense probably benign 0.05
R1116:Clip1 UTSW 5 123579491 missense probably damaging 0.99
R1182:Clip1 UTSW 5 123647865 missense probably damaging 1.00
R1656:Clip1 UTSW 5 123630403 missense possibly damaging 0.61
R1700:Clip1 UTSW 5 123630370 missense probably benign
R1889:Clip1 UTSW 5 123653496 missense probably damaging 0.99
R1975:Clip1 UTSW 5 123623218 missense possibly damaging 0.79
R2406:Clip1 UTSW 5 123603660 missense probably damaging 1.00
R3545:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3547:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3548:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3911:Clip1 UTSW 5 123590834 missense probably damaging 1.00
R3944:Clip1 UTSW 5 123617829 unclassified probably benign
R4660:Clip1 UTSW 5 123579374 missense probably damaging 0.98
R4784:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4785:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4824:Clip1 UTSW 5 123631023 missense probably damaging 1.00
R4831:Clip1 UTSW 5 123583601 missense probably damaging 1.00
R4951:Clip1 UTSW 5 123630345 missense probably benign 0.02
R4960:Clip1 UTSW 5 123654003 nonsense probably null
R5014:Clip1 UTSW 5 123617730 missense probably damaging 0.99
R5116:Clip1 UTSW 5 123630707 missense probably benign 0.05
R5212:Clip1 UTSW 5 123630681 missense probably benign 0.09
R5238:Clip1 UTSW 5 123647883 missense probably damaging 1.00
R5318:Clip1 UTSW 5 123613084 unclassified probably benign
R5372:Clip1 UTSW 5 123630240 missense probably benign 0.02
R5701:Clip1 UTSW 5 123613303 unclassified probably benign
R5734:Clip1 UTSW 5 123615154 unclassified probably benign
R5757:Clip1 UTSW 5 123627397 missense probably benign 0.21
R6024:Clip1 UTSW 5 123615089 missense possibly damaging 0.66
R6177:Clip1 UTSW 5 123613834 unclassified probably benign
R6183:Clip1 UTSW 5 123642604 missense probably damaging 1.00
R6377:Clip1 UTSW 5 123603654 missense possibly damaging 0.50
R6436:Clip1 UTSW 5 123641785 missense probably damaging 1.00
R6471:Clip1 UTSW 5 123640549 missense probably damaging 0.99
R6766:Clip1 UTSW 5 123614764 unclassified probably benign
R7015:Clip1 UTSW 5 123613612 unclassified probably benign
R7094:Clip1 UTSW 5 123623270 missense probably benign 0.02
R7143:Clip1 UTSW 5 123653610 missense probably benign
R7222:Clip1 UTSW 5 123611841 missense probably damaging 0.99
R7233:Clip1 UTSW 5 123611859 missense probably damaging 1.00
R7238:Clip1 UTSW 5 123613265 missense
R7249:Clip1 UTSW 5 123603600 missense probably damaging 1.00
R7283:Clip1 UTSW 5 123613794 missense
R7295:Clip1 UTSW 5 123627356 missense probably benign 0.19
R7447:Clip1 UTSW 5 123653633 missense probably benign 0.03
R7458:Clip1 UTSW 5 123640546 missense probably damaging 1.00
R7483:Clip1 UTSW 5 123617384 missense probably benign 0.00
R7516:Clip1 UTSW 5 123583385 missense probably benign 0.00
R7619:Clip1 UTSW 5 123614279 missense
R7831:Clip1 UTSW 5 123613279 missense
R7897:Clip1 UTSW 5 123622798 missense probably benign
R8155:Clip1 UTSW 5 123613636 missense
R8157:Clip1 UTSW 5 123630719 missense probably benign 0.17
R8232:Clip1 UTSW 5 123647918 missense probably benign 0.05
R8396:Clip1 UTSW 5 123642564 missense probably damaging 1.00
R8446:Clip1 UTSW 5 123655945 missense probably damaging 1.00
R8486:Clip1 UTSW 5 123614707 unclassified probably benign
R8511:Clip1 UTSW 5 123653906 missense possibly damaging 0.50
Z1177:Clip1 UTSW 5 123617350 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTTGTCCTGGAGCACCTC -3'
(R):5'- CCAGCAGACGTTAATCCTGG -3'

Sequencing Primer
(F):5'- CGCAGGTCATCCAGTATCTTGG -3'
(R):5'- CAGCAGACGTTAATCCTGGAGAAG -3'
Posted On2017-10-10