Mutagenetix > Incidental Mutations

Incidental Mutation 'R6160:Gucy2c'

489802

Institutional Source

Beutler Lab

Gene Symbol

Gucy2c

Ensembl Gene

ENSMUSG00000042638

Gene Name

guanylate cyclase 2c

Synonyms

GC-C

MMRRC Submission

044307-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6160 (G1)

Quality Score

170.009

Status

Validated

Chromosome

Chromosomal Location

136697284-136781765 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 136740686 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 430 (Q430*)

Ref Sequence

ENSEMBL: ENSMUSP00000077236 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]

Predicted Effect

probably null
Transcript: ENSMUST00000032338
AA Change: Q430*

SMART Domains

Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: Q430*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	113	384	3.7e-8	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	498	744	3.4e-33	PFAM
Pfam:Pkinase	499	744	1e-26	PFAM
CYCc	787	982	2.68e-107	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000078095
AA Change: Q430*

SMART Domains

Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: Q430*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	53	385	2.7e-41	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	475	720	6.5e-32	PFAM
Pfam:Pkinase	480	720	7.2e-25	PFAM
CYCc	763	958	2.68e-107	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

94% (62/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	G	A	6: 149,331,507		probably null	Het
4930433I11Rik	T	A	7: 40,993,526	S297R	possibly damaging	Het
5530400C23Rik	A	G	6: 133,294,326	E111G	possibly damaging	Het
8030423J24Rik	T	A	13: 70,883,910	S34T	unknown	Het
Ace3	T	A	11: 105,994,732	W20R	possibly damaging	Het
Adgrf1	A	G	17: 43,310,687	E605G	probably damaging	Het
Arhgap44	G	A	11: 65,162,549		probably benign	Het
Atm	A	C	9: 53,490,959	H1404Q	probably benign	Het
AW209491	A	G	13: 14,636,721	E53G	probably damaging	Het
Cdt1	C	T	8: 122,571,368	T366I	probably benign	Het
Cerk	A	T	15: 86,142,773	C179S	probably benign	Het
Cldn10	T	C	14: 118,861,843	V123A	possibly damaging	Het
Clip1	T	C	5: 123,613,541	K726E	possibly damaging	Het
Dcaf12	A	T	4: 41,294,043	Y365N	probably damaging	Het
Dennd6b	A	G	15: 89,188,821	L171P	probably damaging	Het
Dip2c	G	A	13: 9,533,254	V91I	probably benign	Het
Dlec1	A	G	9: 119,143,319	I1431V	probably benign	Het
Egln1	T	C	8: 124,948,492	D188G	probably damaging	Het
Enpp5	T	A	17: 44,081,368	N229K	possibly damaging	Het
Fmo1	T	G	1: 162,836,298	I221L	probably benign	Het
Fsip2	G	A	2: 82,987,945	W4674*	probably null	Het
Gm12185	G	A	11: 48,908,428	Q413*	probably null	Het
Gm5096	G	A	18: 87,757,121	C256Y	probably damaging	Het
Gm7298	A	T	6: 121,764,927	H436L	probably benign	Het
Hgd	A	G	16: 37,613,298	H134R	probably damaging	Het
Hoxd8	A	G	2: 74,705,999	E151G	probably damaging	Het
Il15ra	A	G	2: 11,720,016	D99G	probably damaging	Het
Ints4	T	A	7: 97,509,583		probably null	Het
Itgb1	T	A	8: 128,720,283	F426L	possibly damaging	Het
Itpr1	A	C	6: 108,518,755	I2534L	probably benign	Het
Kcnq4	T	A	4: 120,716,559	H235L	probably damaging	Het
Kcnt1	T	A	2: 25,892,383	I178N	probably damaging	Het
Kidins220	A	G	12: 24,997,311	D252G	probably damaging	Het
Krt23	A	G	11: 99,485,718	I204T	probably damaging	Het
Lipo4	A	G	19: 33,503,293	L225P	probably damaging	Het
Lrp3	T	C	7: 35,204,123	D245G	possibly damaging	Het
Mmp16	A	G	4: 18,051,857	D282G	probably damaging	Het
Myo1c	A	T	11: 75,650,742	H18L	probably benign	Het
Myo1f	C	A	17: 33,604,344	P981Q	probably benign	Het
Nle1	A	T	11: 82,908,157	F33I	probably benign	Het
Nlrp4e	T	G	7: 23,321,306	M406R	probably damaging	Het
Obscn	A	T	11: 59,051,785	V4857E	probably damaging	Het
Palb2	A	T	7: 122,128,420		probably null	Het
Phospho1	A	T	11: 95,830,624	E22V	probably damaging	Het
Pom121l2	C	T	13: 21,983,668	S703L	possibly damaging	Het
Prex2	T	C	1: 10,993,851	L20P	probably damaging	Het
Psmb7	T	C	2: 38,643,381	T45A	probably damaging	Het
R3hdm2	T	C	10: 127,484,507	I532T	probably damaging	Het
Rcn1	T	C	2: 105,392,017	D208G	probably damaging	Het
Recql5	A	G	11: 115,932,787		probably null	Het
Rfc4	A	T	16: 23,114,683	I242N	probably damaging	Het
Rims1	T	C	1: 22,432,984	Y650C	probably damaging	Het
Shc2	C	T	10: 79,627,019		probably null	Het
Slc14a2	A	T	18: 78,158,975		probably null	Het
Slc6a6	A	T	6: 91,740,014		probably null	Het
Synj2	C	A	17: 6,008,061	H275N	possibly damaging	Het
T	A	T	17: 8,441,786	T410S	probably benign	Het
Tarsl2	A	G	7: 65,682,779	I543V	probably benign	Het
Tbc1d8	T	A	1: 39,372,403	K1117N	probably damaging	Het
Tm7sf3	A	T	6: 146,606,289	L425*	probably null	Het
Trav14-3	A	G	14: 53,763,521	Y63C	probably damaging	Het
Tyro3	A	C	2: 119,803,270	D133A	probably damaging	Het
Vmn1r119	T	G	7: 21,011,815	H214P	possibly damaging	Het
Vmn2r120	G	A	17: 57,509,418	P646S	probably benign	Het
Zbtb7c	A	T	18: 76,145,833	Y454F	probably benign	Het
Zmym2	T	C	14: 56,950,309	L1144P	probably damaging	Het

Other mutations in Gucy2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00849:Gucy2c	APN	6	136765614	missense	probably benign	0.01
IGL01081:Gucy2c	APN	6	136702739	missense	probably damaging	1.00
IGL01285:Gucy2c	APN	6	136709741	missense	probably damaging	1.00
IGL01395:Gucy2c	APN	6	136698029	missense	probably damaging	1.00
IGL01408:Gucy2c	APN	6	136698011	missense	probably benign	0.19
IGL01752:Gucy2c	APN	6	136770108	missense	probably benign	0.10
IGL01766:Gucy2c	APN	6	136715973	missense	probably benign	0.43
IGL02245:Gucy2c	APN	6	136729203	missense	probably benign	0.00
IGL02648:Gucy2c	APN	6	136729213	nonsense	probably null
IGL02794:Gucy2c	APN	6	136713148	missense	probably damaging	1.00
IGL03023:Gucy2c	APN	6	136702796	splice site	probably null
IGL03178:Gucy2c	APN	6	136729239	splice site	probably benign
IGL03310:Gucy2c	APN	6	136751046	missense	probably benign
IGL03374:Gucy2c	APN	6	136765630	missense	probably benign	0.00
IGL03393:Gucy2c	APN	6	136719667	missense	probably benign	0.04
BB001:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
BB011:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
R0031:Gucy2c	UTSW	6	136697999	missense	probably damaging	0.99
R0128:Gucy2c	UTSW	6	136704249	missense	probably damaging	1.00
R0377:Gucy2c	UTSW	6	136750917	critical splice donor site	probably null
R0593:Gucy2c	UTSW	6	136728335	missense	probably damaging	0.99
R0613:Gucy2c	UTSW	6	136760723	missense	probably damaging	1.00
R0723:Gucy2c	UTSW	6	136727801	splice site	probably null
R0828:Gucy2c	UTSW	6	136709748	missense	probably damaging	1.00
R0837:Gucy2c	UTSW	6	136722420	missense	probably damaging	0.99
R0880:Gucy2c	UTSW	6	136709832	critical splice acceptor site	probably null
R1350:Gucy2c	UTSW	6	136743914	critical splice donor site	probably null
R1487:Gucy2c	UTSW	6	136748826	missense	possibly damaging	0.79
R1680:Gucy2c	UTSW	6	136722493	missense	probably damaging	1.00
R1751:Gucy2c	UTSW	6	136748775	splice site	probably benign
R1791:Gucy2c	UTSW	6	136744027	missense	probably damaging	1.00
R1953:Gucy2c	UTSW	6	136704293	missense	probably damaging	1.00
R2135:Gucy2c	UTSW	6	136723728	missense	probably damaging	1.00
R2227:Gucy2c	UTSW	6	136702760	missense	probably damaging	1.00
R2350:Gucy2c	UTSW	6	136763074	missense	probably damaging	0.98
R2906:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R2907:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R3699:Gucy2c	UTSW	6	136770111	missense	probably damaging	1.00
R3972:Gucy2c	UTSW	6	136708366	missense	probably damaging	1.00
R4613:Gucy2c	UTSW	6	136708321	missense	probably damaging	1.00
R4732:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4733:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4776:Gucy2c	UTSW	6	136722514	missense	probably damaging	1.00
R5087:Gucy2c	UTSW	6	136767035	missense	possibly damaging	0.69
R5284:Gucy2c	UTSW	6	136763043	missense	possibly damaging	0.56
R5366:Gucy2c	UTSW	6	136720741	missense	probably damaging	0.99
R5466:Gucy2c	UTSW	6	136781465	nonsense	probably null
R5911:Gucy2c	UTSW	6	136722442	missense	probably damaging	1.00
R6367:Gucy2c	UTSW	6	136709778	missense	probably damaging	1.00
R6441:Gucy2c	UTSW	6	136723761	missense	probably damaging	0.98
R6812:Gucy2c	UTSW	6	136697995	missense	probably benign
R6865:Gucy2c	UTSW	6	136770129	missense	probably benign	0.13
R7065:Gucy2c	UTSW	6	136720766	missense	probably damaging	1.00
R7078:Gucy2c	UTSW	6	136697939	missense	probably benign	0.19
R7096:Gucy2c	UTSW	6	136728341	missense	probably benign	0.11
R7138:Gucy2c	UTSW	6	136728344	missense	probably damaging	1.00
R7343:Gucy2c	UTSW	6	136702748	missense	probably damaging	1.00
R7538:Gucy2c	UTSW	6	136709744	missense	probably damaging	1.00
R7587:Gucy2c	UTSW	6	136704290	missense	probably damaging	1.00
R7666:Gucy2c	UTSW	6	136697968	missense	probably benign
R7675:Gucy2c	UTSW	6	136716032	missense	possibly damaging	0.91
R7822:Gucy2c	UTSW	6	136708406	missense	probably damaging	1.00
R7842:Gucy2c	UTSW	6	136769816	splice site	probably null
R7924:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
R8078:Gucy2c	UTSW	6	136697921	missense	probably damaging	1.00
R8094:Gucy2c	UTSW	6	136737448	missense	probably benign	0.33
R8391:Gucy2c	UTSW	6	136704215	missense	probably damaging	1.00
R8428:Gucy2c	UTSW	6	136727894	missense	probably damaging	0.96
Z1088:Gucy2c	UTSW	6	136743981	missense	probably benign
Z1177:Gucy2c	UTSW	6	136719687	missense	probably damaging	1.00
Z1177:Gucy2c	UTSW	6	136767196	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCTAGATCCCAGGTCTGCC -3'
(R):5'- CTCTGAGCTACTTAGGAAGAGGAG -3'

Sequencing Primer
(F):5'- CTTTTTCATCAAGCACCGCCAATG -3'
(R):5'- GGGAGGAGCAGAGCCTG -3'

Posted On

2017-10-10