Incidental Mutation 'R6160:Gucy2c'
ID489802
Institutional Source Beutler Lab
Gene Symbol Gucy2c
Ensembl Gene ENSMUSG00000042638
Gene Nameguanylate cyclase 2c
SynonymsGC-C
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6160 (G1)
Quality Score170.009
Status Validated
Chromosome6
Chromosomal Location136697284-136781765 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 136740686 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 430 (Q430*)
Ref Sequence ENSEMBL: ENSMUSP00000077236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]
Predicted Effect probably null
Transcript: ENSMUST00000032338
AA Change: Q430*
SMART Domains Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: Q430*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 113 384 3.7e-8 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 498 744 3.4e-33 PFAM
Pfam:Pkinase 499 744 1e-26 PFAM
CYCc 787 982 2.68e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078095
AA Change: Q430*
SMART Domains Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: Q430*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 53 385 2.7e-41 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 475 720 6.5e-32 PFAM
Pfam:Pkinase 480 720 7.2e-25 PFAM
CYCc 763 958 2.68e-107 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Gucy2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Gucy2c APN 6 136765614 missense probably benign 0.01
IGL01081:Gucy2c APN 6 136702739 missense probably damaging 1.00
IGL01285:Gucy2c APN 6 136709741 missense probably damaging 1.00
IGL01395:Gucy2c APN 6 136698029 missense probably damaging 1.00
IGL01408:Gucy2c APN 6 136698011 missense probably benign 0.19
IGL01752:Gucy2c APN 6 136770108 missense probably benign 0.10
IGL01766:Gucy2c APN 6 136715973 missense probably benign 0.43
IGL02245:Gucy2c APN 6 136729203 missense probably benign 0.00
IGL02648:Gucy2c APN 6 136729213 nonsense probably null
IGL02794:Gucy2c APN 6 136713148 missense probably damaging 1.00
IGL03023:Gucy2c APN 6 136702796 splice site probably null
IGL03178:Gucy2c APN 6 136729239 splice site probably benign
IGL03310:Gucy2c APN 6 136751046 missense probably benign
IGL03374:Gucy2c APN 6 136765630 missense probably benign 0.00
IGL03393:Gucy2c APN 6 136719667 missense probably benign 0.04
R0031:Gucy2c UTSW 6 136697999 missense probably damaging 0.99
R0128:Gucy2c UTSW 6 136704249 missense probably damaging 1.00
R0377:Gucy2c UTSW 6 136750917 critical splice donor site probably null
R0593:Gucy2c UTSW 6 136728335 missense probably damaging 0.99
R0613:Gucy2c UTSW 6 136760723 missense probably damaging 1.00
R0723:Gucy2c UTSW 6 136727801 splice site probably null
R0828:Gucy2c UTSW 6 136709748 missense probably damaging 1.00
R0837:Gucy2c UTSW 6 136722420 missense probably damaging 0.99
R0880:Gucy2c UTSW 6 136709832 critical splice acceptor site probably null
R1350:Gucy2c UTSW 6 136743914 critical splice donor site probably null
R1487:Gucy2c UTSW 6 136748826 missense possibly damaging 0.79
R1680:Gucy2c UTSW 6 136722493 missense probably damaging 1.00
R1751:Gucy2c UTSW 6 136748775 splice site probably benign
R1791:Gucy2c UTSW 6 136744027 missense probably damaging 1.00
R1953:Gucy2c UTSW 6 136704293 missense probably damaging 1.00
R2135:Gucy2c UTSW 6 136723728 missense probably damaging 1.00
R2227:Gucy2c UTSW 6 136702760 missense probably damaging 1.00
R2350:Gucy2c UTSW 6 136763074 missense probably damaging 0.98
R2906:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R2907:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R3699:Gucy2c UTSW 6 136770111 missense probably damaging 1.00
R3972:Gucy2c UTSW 6 136708366 missense probably damaging 1.00
R4613:Gucy2c UTSW 6 136708321 missense probably damaging 1.00
R4732:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4733:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4776:Gucy2c UTSW 6 136722514 missense probably damaging 1.00
R5087:Gucy2c UTSW 6 136767035 missense possibly damaging 0.69
R5284:Gucy2c UTSW 6 136763043 missense possibly damaging 0.56
R5366:Gucy2c UTSW 6 136720741 missense probably damaging 0.99
R5466:Gucy2c UTSW 6 136781465 nonsense probably null
R5911:Gucy2c UTSW 6 136722442 missense probably damaging 1.00
R6367:Gucy2c UTSW 6 136709778 missense probably damaging 1.00
R6441:Gucy2c UTSW 6 136723761 missense probably damaging 0.98
R6812:Gucy2c UTSW 6 136697995 missense probably benign
R6865:Gucy2c UTSW 6 136770129 missense probably benign 0.13
R7065:Gucy2c UTSW 6 136720766 missense probably damaging 1.00
R7078:Gucy2c UTSW 6 136697939 missense probably benign 0.19
R7096:Gucy2c UTSW 6 136728341 missense probably benign 0.11
R7138:Gucy2c UTSW 6 136728344 missense probably damaging 1.00
R7343:Gucy2c UTSW 6 136702748 missense probably damaging 1.00
R7538:Gucy2c UTSW 6 136709744 missense probably damaging 1.00
R7587:Gucy2c UTSW 6 136704290 missense probably damaging 1.00
R7666:Gucy2c UTSW 6 136697968 missense probably benign
R7675:Gucy2c UTSW 6 136716032 missense possibly damaging 0.91
Z1088:Gucy2c UTSW 6 136743981 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTAGATCCCAGGTCTGCC -3'
(R):5'- CTCTGAGCTACTTAGGAAGAGGAG -3'

Sequencing Primer
(F):5'- CTTTTTCATCAAGCACCGCCAATG -3'
(R):5'- GGGAGGAGCAGAGCCTG -3'
Posted On2017-10-10