Incidental Mutation 'R6160:Nlrp4e'
ID 489806
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission 044307-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6160 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23000617-23061702 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 23020731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 406 (M406R)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect probably damaging
Transcript: ENSMUST00000076470
AA Change: M406R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: M406R

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,642,950 (GRCm39) S297R possibly damaging Het
5530400C23Rik A G 6: 133,271,289 (GRCm39) E111G possibly damaging Het
8030423J24Rik T A 13: 71,032,029 (GRCm39) S34T unknown Het
Ace3 T A 11: 105,885,558 (GRCm39) W20R possibly damaging Het
Adgrf1 A G 17: 43,621,578 (GRCm39) E605G probably damaging Het
Arhgap44 G A 11: 65,053,375 (GRCm39) probably benign Het
Atm A C 9: 53,402,259 (GRCm39) H1404Q probably benign Het
AW209491 A G 13: 14,811,306 (GRCm39) E53G probably damaging Het
Bhmt1b G A 18: 87,775,245 (GRCm39) C256Y probably damaging Het
Cdt1 C T 8: 123,298,107 (GRCm39) T366I probably benign Het
Cerk A T 15: 86,026,974 (GRCm39) C179S probably benign Het
Cldn10 T C 14: 119,099,255 (GRCm39) V123A possibly damaging Het
Clip1 T C 5: 123,751,604 (GRCm39) K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 (GRCm39) Y365N probably damaging Het
Dennd6b A G 15: 89,073,024 (GRCm39) L171P probably damaging Het
Dip2c G A 13: 9,583,290 (GRCm39) V91I probably benign Het
Dlec1 A G 9: 118,972,387 (GRCm39) I1431V probably benign Het
Egln1 T C 8: 125,675,231 (GRCm39) D188G probably damaging Het
Enpp5 T A 17: 44,392,259 (GRCm39) N229K possibly damaging Het
Fmo1 T G 1: 162,663,867 (GRCm39) I221L probably benign Het
Fsip2 G A 2: 82,818,289 (GRCm39) W4674* probably null Het
Gm12185 G A 11: 48,799,255 (GRCm39) Q413* probably null Het
Gm7298 A T 6: 121,741,886 (GRCm39) H436L probably benign Het
Gucy2c G A 6: 136,717,684 (GRCm39) Q430* probably null Het
Hgd A G 16: 37,433,660 (GRCm39) H134R probably damaging Het
Hoxd8 A G 2: 74,536,343 (GRCm39) E151G probably damaging Het
Il15ra A G 2: 11,724,827 (GRCm39) D99G probably damaging Het
Ints4 T A 7: 97,158,790 (GRCm39) probably null Het
Itgb1 T A 8: 129,446,764 (GRCm39) F426L possibly damaging Het
Itpr1 A C 6: 108,495,716 (GRCm39) I2534L probably benign Het
Kcnq4 T A 4: 120,573,756 (GRCm39) H235L probably damaging Het
Kcnt1 T A 2: 25,782,395 (GRCm39) I178N probably damaging Het
Kidins220 A G 12: 25,047,310 (GRCm39) D252G probably damaging Het
Krt23 A G 11: 99,376,544 (GRCm39) I204T probably damaging Het
Lipo4 A G 19: 33,480,693 (GRCm39) L225P probably damaging Het
Lrp3 T C 7: 34,903,548 (GRCm39) D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 (GRCm39) D282G probably damaging Het
Myo1c A T 11: 75,541,568 (GRCm39) H18L probably benign Het
Myo1f C A 17: 33,823,318 (GRCm39) P981Q probably benign Het
Nle1 A T 11: 82,798,983 (GRCm39) F33I probably benign Het
Obscn A T 11: 58,942,611 (GRCm39) V4857E probably damaging Het
Palb2 A T 7: 121,727,643 (GRCm39) probably null Het
Phospho1 A T 11: 95,721,450 (GRCm39) E22V probably damaging Het
Pom121l2 C T 13: 22,167,838 (GRCm39) S703L possibly damaging Het
Prex2 T C 1: 11,064,075 (GRCm39) L20P probably damaging Het
Psmb7 T C 2: 38,533,393 (GRCm39) T45A probably damaging Het
R3hdm2 T C 10: 127,320,376 (GRCm39) I532T probably damaging Het
Rcn1 T C 2: 105,222,362 (GRCm39) D208G probably damaging Het
Recql5 A G 11: 115,823,613 (GRCm39) probably null Het
Resf1 G A 6: 149,233,005 (GRCm39) probably null Het
Rfc4 A T 16: 22,933,433 (GRCm39) I242N probably damaging Het
Rims1 T C 1: 22,503,235 (GRCm39) Y650C probably damaging Het
Shc2 C T 10: 79,462,853 (GRCm39) probably null Het
Slc14a2 A T 18: 78,202,190 (GRCm39) probably null Het
Slc6a6 A T 6: 91,716,995 (GRCm39) probably null Het
Synj2 C A 17: 6,058,336 (GRCm39) H275N possibly damaging Het
T A T 17: 8,660,618 (GRCm39) T410S probably benign Het
Tars3 A G 7: 65,332,527 (GRCm39) I543V probably benign Het
Tbc1d8 T A 1: 39,411,484 (GRCm39) K1117N probably damaging Het
Tm7sf3 A T 6: 146,507,787 (GRCm39) L425* probably null Het
Trav14-3 A G 14: 54,000,978 (GRCm39) Y63C probably damaging Het
Tyro3 A C 2: 119,633,751 (GRCm39) D133A probably damaging Het
Vmn1r119 T G 7: 20,745,740 (GRCm39) H214P possibly damaging Het
Vmn2r120 G A 17: 57,816,418 (GRCm39) P646S probably benign Het
Zbtb7c A T 18: 76,278,904 (GRCm39) Y454F probably benign Het
Zmym2 T C 14: 57,187,766 (GRCm39) L1144P probably damaging Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23,042,565 (GRCm39) missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23,039,896 (GRCm39) missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23,021,092 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23,052,586 (GRCm39) splice site probably benign
IGL01815:Nlrp4e APN 7 23,020,863 (GRCm39) missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23,020,255 (GRCm39) nonsense probably null
IGL02245:Nlrp4e APN 7 23,020,300 (GRCm39) missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23,020,716 (GRCm39) missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23,021,264 (GRCm39) missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23,000,858 (GRCm39) missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23,000,799 (GRCm39) missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23,020,251 (GRCm39) missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23,052,768 (GRCm39) critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23,020,251 (GRCm39) missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23,054,628 (GRCm39) missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23,021,169 (GRCm39) missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23,020,397 (GRCm39) missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23,052,763 (GRCm39) missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23,021,085 (GRCm39) missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23,019,797 (GRCm39) missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23,021,268 (GRCm39) missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23,020,458 (GRCm39) missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23,020,420 (GRCm39) missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23,020,671 (GRCm39) missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23,054,686 (GRCm39) missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23,020,802 (GRCm39) missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23,039,988 (GRCm39) missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23,020,228 (GRCm39) missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4387:Nlrp4e UTSW 7 23,000,902 (GRCm39) missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23,000,902 (GRCm39) missense probably benign 0.00
R4389:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23,020,888 (GRCm39) nonsense probably null
R4444:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23,020,652 (GRCm39) missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23,036,291 (GRCm39) missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23,020,404 (GRCm39) missense probably benign
R4666:Nlrp4e UTSW 7 23,036,205 (GRCm39) nonsense probably null
R4721:Nlrp4e UTSW 7 23,020,521 (GRCm39) missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23,020,989 (GRCm39) missense probably benign
R4758:Nlrp4e UTSW 7 23,020,043 (GRCm39) missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23,042,525 (GRCm39) missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23,036,165 (GRCm39) missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23,061,318 (GRCm39) nonsense probably null
R5277:Nlrp4e UTSW 7 23,020,863 (GRCm39) missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23,052,598 (GRCm39) missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23,021,190 (GRCm39) missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23,036,316 (GRCm39) missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23,019,914 (GRCm39) missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23,020,602 (GRCm39) missense probably benign
R5683:Nlrp4e UTSW 7 23,052,697 (GRCm39) missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23,052,597 (GRCm39) missense probably benign
R6427:Nlrp4e UTSW 7 23,020,058 (GRCm39) missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23,020,740 (GRCm39) missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23,036,156 (GRCm39) critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23,020,953 (GRCm39) missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23,021,182 (GRCm39) missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23,019,931 (GRCm39) missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23,039,965 (GRCm39) missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23,020,983 (GRCm39) missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23,020,556 (GRCm39) missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23,020,403 (GRCm39) missense probably benign
R9167:Nlrp4e UTSW 7 23,039,951 (GRCm39) missense probably benign 0.00
R9181:Nlrp4e UTSW 7 23,061,270 (GRCm39) nonsense probably null
R9219:Nlrp4e UTSW 7 23,020,941 (GRCm39) missense possibly damaging 0.50
R9229:Nlrp4e UTSW 7 23,020,799 (GRCm39) missense probably benign 0.00
R9321:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9323:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9325:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9379:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9380:Nlrp4e UTSW 7 23,020,755 (GRCm39) missense probably benign
R9448:Nlrp4e UTSW 7 23,000,956 (GRCm39) missense probably benign
R9523:Nlrp4e UTSW 7 23,054,636 (GRCm39) missense probably benign 0.00
R9593:Nlrp4e UTSW 7 23,020,197 (GRCm39) missense probably benign 0.19
X0022:Nlrp4e UTSW 7 23,042,544 (GRCm39) missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23,042,603 (GRCm39) missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23,054,648 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAAAATGAGCAGCTGTTCTCTGTATG -3'
(R):5'- AAGATGGCAGCACAGACCTC -3'

Sequencing Primer
(F):5'- AGCAGCTGTTCTCTGTATGTCAAGTC -3'
(R):5'- CAGACCTCCTGGATAGATGGGTG -3'
Posted On 2017-10-10