Incidental Mutation 'R6160:Cdt1'
List |< first << previous [record 10 of 67] next >> last >|
ID489810
Institutional Source Beutler Lab
Gene Symbol Cdt1
Ensembl Gene ENSMUSG00000006585
Gene Namechromatin licensing and DNA replication factor 1
Synonyms2610318F11Rik, Ris2
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6160 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location122568015-122573554 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122571368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 366 (T366I)
Ref Sequence ENSEMBL: ENSMUSP00000006760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006760] [ENSMUST00000006764] [ENSMUST00000127664] [ENSMUST00000211823] [ENSMUST00000212093] [ENSMUST00000213029] [ENSMUST00000213062]
PDB Structure
Structure of the Cdt1 C-terminal domain [SOLUTION NMR]
Structure of C-terminal region of Cdt1 [SOLUTION NMR]
Crystal structure of Cdt1/geminin complex [X-RAY DIFFRACTION]
Crystal structure of cdt1 C terminal domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006760
AA Change: T366I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006760
Gene: ENSMUSG00000006585
AA Change: T366I

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 72 108 N/A INTRINSIC
CDT1 199 362 3.68e-91 SMART
low complexity region 401 427 N/A INTRINSIC
Pfam:CDT1_C 431 525 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006764
SMART Domains Protein: ENSMUSP00000006764
Gene: ENSMUSG00000006589

DomainStartEndE-ValueType
Pfam:Pribosyltran 28 178 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211810
Predicted Effect probably benign
Transcript: ENSMUST00000211823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212053
Predicted Effect probably benign
Transcript: ENSMUST00000212093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213017
Predicted Effect probably benign
Transcript: ENSMUST00000213029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213030
Predicted Effect probably benign
Transcript: ENSMUST00000213062
Meta Mutation Damage Score 0.0988 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a small in-frame deletion in exon 2 are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Cdt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0014:Cdt1 UTSW 8 122572566 missense probably benign 0.00
R0494:Cdt1 UTSW 8 122572060 missense possibly damaging 0.64
R0614:Cdt1 UTSW 8 122568137 missense probably benign 0.04
R0645:Cdt1 UTSW 8 122572145 unclassified probably benign
R1699:Cdt1 UTSW 8 122569983 missense probably damaging 0.99
R1889:Cdt1 UTSW 8 122572052 missense possibly damaging 0.85
R3114:Cdt1 UTSW 8 122570482 nonsense probably null
R4243:Cdt1 UTSW 8 122571418 missense probably benign 0.04
R4532:Cdt1 UTSW 8 122571756 missense probably benign 0.00
R5496:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5498:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5501:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5523:Cdt1 UTSW 8 122568093 missense possibly damaging 0.95
R5647:Cdt1 UTSW 8 122570208 missense possibly damaging 0.79
R6892:Cdt1 UTSW 8 122570212 missense probably damaging 1.00
R7001:Cdt1 UTSW 8 122572510 missense probably damaging 1.00
R7089:Cdt1 UTSW 8 122571980 missense probably damaging 1.00
R7214:Cdt1 UTSW 8 122568273 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACAGAACAGCTAAGTTGG -3'
(R):5'- TGCGTACAAAGCACACCTTC -3'

Sequencing Primer
(F):5'- GTGTTCTGGTTGGAAATACTGAAATG -3'
(R):5'- GTACAAAGCACACCTTCTTTGTG -3'
Posted On2017-10-10