Mutagenetix > Incidental Mutations

Incidental Mutation 'R6160:Itgb1'

489812

Institutional Source

Beutler Lab

Gene Symbol

Itgb1

Ensembl Gene

ENSMUSG00000025809

Gene Name

integrin beta 1 (fibronectin receptor beta)

Synonyms

Gm9863, Fnrb, CD29, 4633401G24Rik, beta1 integrin

MMRRC Submission

044307-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6160 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128685654-128733200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128720283 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 426 (F426L)

Ref Sequence

ENSEMBL: ENSMUSP00000087457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090006] [ENSMUST00000124826]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090006
AA Change: F426L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000087457
Gene: ENSMUSG00000025809
AA Change: F426L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PSI	26	76	3.01e-7	SMART
INB	34	464	2e-298	SMART
VWA	142	372	1.45e0	SMART
low complexity region	568	581	N/A	INTRINSIC
Pfam:EGF_2	599	630	8.8e-8	PFAM
Integrin_B_tail	640	728	4.58e-37	SMART
transmembrane domain	729	751	N/A	INTRINSIC
Integrin_b_cyt	752	798	3.43e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124826

SMART Domains

Protein: ENSMUSP00000120026
Gene: ENSMUSG00000025809

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3VI4\|D	21	51	2e-16	PDB
Blast:PSI	26	51	1e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000149116

SMART Domains

Protein: ENSMUSP00000119699
Gene: ENSMUSG00000025809

Domain	Start	End	E-Value	Type
Pfam:Integrin_B_tail	1	39	1.9e-12	PFAM
transmembrane domain	40	62	N/A	INTRINSIC
Integrin_b_cyt	63	109	8.77e-25	SMART

Meta Mutation Damage Score

0.9734

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

94% (62/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants die at or soon after implantation. Tissue-specific knockouts exhibit skin blisters, hair-loss, brain and heart defects, and impaired immune responses, wound healing, and hematopoietic stem cell migration, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	G	A	6: 149,331,507		probably null	Het
4930433I11Rik	T	A	7: 40,993,526	S297R	possibly damaging	Het
5530400C23Rik	A	G	6: 133,294,326	E111G	possibly damaging	Het
8030423J24Rik	T	A	13: 70,883,910	S34T	unknown	Het
Ace3	T	A	11: 105,994,732	W20R	possibly damaging	Het
Adgrf1	A	G	17: 43,310,687	E605G	probably damaging	Het
Arhgap44	G	A	11: 65,162,549		probably benign	Het
Atm	A	C	9: 53,490,959	H1404Q	probably benign	Het
AW209491	A	G	13: 14,636,721	E53G	probably damaging	Het
Cdt1	C	T	8: 122,571,368	T366I	probably benign	Het
Cerk	A	T	15: 86,142,773	C179S	probably benign	Het
Cldn10	T	C	14: 118,861,843	V123A	possibly damaging	Het
Clip1	T	C	5: 123,613,541	K726E	possibly damaging	Het
Dcaf12	A	T	4: 41,294,043	Y365N	probably damaging	Het
Dennd6b	A	G	15: 89,188,821	L171P	probably damaging	Het
Dip2c	G	A	13: 9,533,254	V91I	probably benign	Het
Dlec1	A	G	9: 119,143,319	I1431V	probably benign	Het
Egln1	T	C	8: 124,948,492	D188G	probably damaging	Het
Enpp5	T	A	17: 44,081,368	N229K	possibly damaging	Het
Fmo1	T	G	1: 162,836,298	I221L	probably benign	Het
Fsip2	G	A	2: 82,987,945	W4674*	probably null	Het
Gm12185	G	A	11: 48,908,428	Q413*	probably null	Het
Gm5096	G	A	18: 87,757,121	C256Y	probably damaging	Het
Gm7298	A	T	6: 121,764,927	H436L	probably benign	Het
Gucy2c	G	A	6: 136,740,686	Q430*	probably null	Het
Hgd	A	G	16: 37,613,298	H134R	probably damaging	Het
Hoxd8	A	G	2: 74,705,999	E151G	probably damaging	Het
Il15ra	A	G	2: 11,720,016	D99G	probably damaging	Het
Ints4	T	A	7: 97,509,583		probably null	Het
Itpr1	A	C	6: 108,518,755	I2534L	probably benign	Het
Kcnq4	T	A	4: 120,716,559	H235L	probably damaging	Het
Kcnt1	T	A	2: 25,892,383	I178N	probably damaging	Het
Kidins220	A	G	12: 24,997,311	D252G	probably damaging	Het
Krt23	A	G	11: 99,485,718	I204T	probably damaging	Het
Lipo4	A	G	19: 33,503,293	L225P	probably damaging	Het
Lrp3	T	C	7: 35,204,123	D245G	possibly damaging	Het
Mmp16	A	G	4: 18,051,857	D282G	probably damaging	Het
Myo1c	A	T	11: 75,650,742	H18L	probably benign	Het
Myo1f	C	A	17: 33,604,344	P981Q	probably benign	Het
Nle1	A	T	11: 82,908,157	F33I	probably benign	Het
Nlrp4e	T	G	7: 23,321,306	M406R	probably damaging	Het
Obscn	A	T	11: 59,051,785	V4857E	probably damaging	Het
Palb2	A	T	7: 122,128,420		probably null	Het
Phospho1	A	T	11: 95,830,624	E22V	probably damaging	Het
Pom121l2	C	T	13: 21,983,668	S703L	possibly damaging	Het
Prex2	T	C	1: 10,993,851	L20P	probably damaging	Het
Psmb7	T	C	2: 38,643,381	T45A	probably damaging	Het
R3hdm2	T	C	10: 127,484,507	I532T	probably damaging	Het
Rcn1	T	C	2: 105,392,017	D208G	probably damaging	Het
Recql5	A	G	11: 115,932,787		probably null	Het
Rfc4	A	T	16: 23,114,683	I242N	probably damaging	Het
Rims1	T	C	1: 22,432,984	Y650C	probably damaging	Het
Shc2	C	T	10: 79,627,019		probably null	Het
Slc14a2	A	T	18: 78,158,975		probably null	Het
Slc6a6	A	T	6: 91,740,014		probably null	Het
Synj2	C	A	17: 6,008,061	H275N	possibly damaging	Het
T	A	T	17: 8,441,786	T410S	probably benign	Het
Tarsl2	A	G	7: 65,682,779	I543V	probably benign	Het
Tbc1d8	T	A	1: 39,372,403	K1117N	probably damaging	Het
Tm7sf3	A	T	6: 146,606,289	L425*	probably null	Het
Trav14-3	A	G	14: 53,763,521	Y63C	probably damaging	Het
Tyro3	A	C	2: 119,803,270	D133A	probably damaging	Het
Vmn1r119	T	G	7: 21,011,815	H214P	possibly damaging	Het
Vmn2r120	G	A	17: 57,509,418	P646S	probably benign	Het
Zbtb7c	A	T	18: 76,145,833	Y454F	probably benign	Het
Zmym2	T	C	14: 56,950,309	L1144P	probably damaging	Het

Other mutations in Itgb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Itgb1	APN	8	128713918	splice site	probably benign
IGL01407:Itgb1	APN	8	128722834	missense	probably benign	0.08
IGL03025:Itgb1	APN	8	128722584	missense	possibly damaging	0.96
PIT4377001:Itgb1	UTSW	8	128710383	missense	probably damaging	1.00
R0136:Itgb1	UTSW	8	128722854	missense	possibly damaging	0.96
R0244:Itgb1	UTSW	8	128717685	splice site	probably benign
R0483:Itgb1	UTSW	8	128726167	missense	possibly damaging	0.79
R0606:Itgb1	UTSW	8	128722372	unclassified	probably benign
R0657:Itgb1	UTSW	8	128722854	missense	possibly damaging	0.96
R0865:Itgb1	UTSW	8	128710251	critical splice acceptor site	probably null
R1052:Itgb1	UTSW	8	128713305	missense	probably damaging	1.00
R1429:Itgb1	UTSW	8	128717676	critical splice donor site	probably null
R1589:Itgb1	UTSW	8	128705458	missense	probably damaging	0.99
R1589:Itgb1	UTSW	8	128705459	missense	possibly damaging	0.95
R1614:Itgb1	UTSW	8	128720065	missense	probably damaging	1.00
R1672:Itgb1	UTSW	8	128732045	missense	probably damaging	1.00
R1723:Itgb1	UTSW	8	128726038	missense	probably damaging	0.98
R1865:Itgb1	UTSW	8	128720457	missense	probably benign	0.01
R3786:Itgb1	UTSW	8	128713358	missense	probably damaging	1.00
R4223:Itgb1	UTSW	8	128714143	missense	probably damaging	1.00
R4756:Itgb1	UTSW	8	128717222	missense	probably damaging	0.98
R4826:Itgb1	UTSW	8	128720308	missense	probably damaging	1.00
R4880:Itgb1	UTSW	8	128716150	missense	probably damaging	1.00
R5202:Itgb1	UTSW	8	128720010	missense	probably damaging	0.99
R5682:Itgb1	UTSW	8	128727068	splice site	probably null
R5935:Itgb1	UTSW	8	128713237	nonsense	probably null
R6156:Itgb1	UTSW	8	128732054	missense	possibly damaging	0.79
R6248:Itgb1	UTSW	8	128722421	missense	possibly damaging	0.80
R6812:Itgb1	UTSW	8	128705410	splice site	probably null
R6869:Itgb1	UTSW	8	128720035	missense	probably benign	0.01
R7249:Itgb1	UTSW	8	128720404	missense	probably benign	0.28
R7496:Itgb1	UTSW	8	128720305	missense	probably benign
R7679:Itgb1	UTSW	8	128720448	missense	probably damaging	0.99
Z1088:Itgb1	UTSW	8	128713369	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCTATTGCAAGAATGGGGTG -3'
(R):5'- AGGCTCCACACTCAAATGTC -3'

Sequencing Primer
(F):5'- CGAAAGTGTTCCAACATTTCTATTGG -3'
(R):5'- AAATGTCCCATTTCCCTCATGG -3'

Posted On

2017-10-10