Incidental Mutation 'R6160:Myo1c'
ID489820
Institutional Source Beutler Lab
Gene Symbol Myo1c
Ensembl Gene ENSMUSG00000017774
Gene Namemyosin IC
SynonymsC80397, myosin-Ibeta, myr2, mm1beta
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R6160 (G1)
Quality Score198.009
Status Validated
Chromosome11
Chromosomal Location75650504-75673910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75650742 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 18 (H18L)
Ref Sequence ENSEMBL: ENSMUSP00000099563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006286] [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000139856] [ENSMUST00000150857]
Predicted Effect probably benign
Transcript: ENSMUST00000006286
SMART Domains Protein: ENSMUSP00000006286
Gene: ENSMUSG00000006127

DomainStartEndE-ValueType
IPPc 30 345 1.03e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069057
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102504
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102505
AA Change: H18L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774
AA Change: H18L

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136605
Predicted Effect probably benign
Transcript: ENSMUST00000139856
SMART Domains Protein: ENSMUSP00000121060
Gene: ENSMUSG00000006127

DomainStartEndE-ValueType
Blast:IPPc 18 94 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149134
Predicted Effect probably benign
Transcript: ENSMUST00000150857
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The protein functions in intracellular vesicle transport to the plasma membrane. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in (Y61G) mutation that sensitizes to N6-modified ADP analogs display altered fast adaption in vestibular hair cells. Mice homozygous for a nuclear isoform-specifc knock-out allele exhibit minor changes in bone marrow density and red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Myo1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Myo1c APN 11 75672250 missense probably damaging 1.00
IGL02054:Myo1c APN 11 75661136 missense probably benign 0.30
IGL02115:Myo1c APN 11 75661591 missense probably damaging 0.99
IGL02375:Myo1c APN 11 75661574 missense probably benign 0.00
IGL02878:Myo1c APN 11 75669033 missense possibly damaging 0.93
IGL03008:Myo1c APN 11 75658414 missense probably benign 0.13
Sweeper UTSW 11 75670030 nonsense probably null
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0138:Myo1c UTSW 11 75661001 missense possibly damaging 0.92
R0200:Myo1c UTSW 11 75672182 missense probably benign 0.00
R0227:Myo1c UTSW 11 75658694 missense probably benign 0.34
R0257:Myo1c UTSW 11 75665516 critical splice acceptor site probably null
R0513:Myo1c UTSW 11 75665831 splice site probably null
R0587:Myo1c UTSW 11 75657790 missense probably damaging 1.00
R0667:Myo1c UTSW 11 75668512 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1793:Myo1c UTSW 11 75657589 missense probably damaging 0.98
R1922:Myo1c UTSW 11 75668229 missense probably benign
R2000:Myo1c UTSW 11 75670579 missense probably damaging 1.00
R3983:Myo1c UTSW 11 75661499 missense probably benign 0.05
R4583:Myo1c UTSW 11 75671862 missense possibly damaging 0.72
R4599:Myo1c UTSW 11 75668193 missense probably damaging 0.99
R4671:Myo1c UTSW 11 75670030 nonsense probably null
R4682:Myo1c UTSW 11 75670030 nonsense probably null
R4708:Myo1c UTSW 11 75670030 nonsense probably null
R4709:Myo1c UTSW 11 75670030 nonsense probably null
R4742:Myo1c UTSW 11 75670030 nonsense probably null
R4770:Myo1c UTSW 11 75660313 nonsense probably null
R4888:Myo1c UTSW 11 75669227 missense probably damaging 1.00
R4915:Myo1c UTSW 11 75656309 start codon destroyed probably null
R4934:Myo1c UTSW 11 75671850 missense probably damaging 1.00
R4971:Myo1c UTSW 11 75671588 missense probably damaging 1.00
R5319:Myo1c UTSW 11 75662026 missense possibly damaging 0.95
R5589:Myo1c UTSW 11 75657588 missense possibly damaging 0.74
R5624:Myo1c UTSW 11 75662635 missense probably damaging 0.99
R5756:Myo1c UTSW 11 75658414 missense probably benign 0.42
R5959:Myo1c UTSW 11 75657519 missense probably benign 0.37
R6559:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6568:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6569:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6574:Myo1c UTSW 11 75656298 start gained probably benign
R6579:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6580:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6583:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6640:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6642:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6643:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6679:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6680:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6687:Myo1c UTSW 11 75672201 missense probably benign
R6695:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6696:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6700:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6712:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6713:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6715:Myo1c UTSW 11 75671635 missense probably benign 0.42
R7081:Myo1c UTSW 11 75660963 missense probably benign
R7265:Myo1c UTSW 11 75669790 missense possibly damaging 0.89
R7397:Myo1c UTSW 11 75671242 missense probably benign 0.17
R7586:Myo1c UTSW 11 75657519 missense possibly damaging 0.77
R7714:Myo1c UTSW 11 75658693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGCATTTCCTCCATCC -3'
(R):5'- TAATGGTTTCTGTCCCCAGC -3'

Sequencing Primer
(F):5'- TCCAGCTGTGTCCTGAGAAG -3'
(R):5'- GTTTCTGTCCCCAGCAAAGATCAG -3'
Posted On2017-10-10