Incidental Mutation 'R6160:Phospho1'
ID489822
Institutional Source Beutler Lab
Gene Symbol Phospho1
Ensembl Gene ENSMUSG00000050860
Gene Namephosphatase, orphan 1
SynonymsD11Moh36
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6160 (G1)
Quality Score94.0077
Status Validated
Chromosome11
Chromosomal Location95824499-95832140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95830624 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 22 (E22V)
Ref Sequence ENSEMBL: ENSMUSP00000117244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054173] [ENSMUST00000059026] [ENSMUST00000133070] [ENSMUST00000150134]
Predicted Effect probably damaging
Transcript: ENSMUST00000054173
AA Change: E40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057858
Gene: ENSMUSG00000050860
AA Change: E40V

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 27 264 6.9e-103 PFAM
Pfam:HAD 29 211 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059026
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131049
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137645
SMART Domains Protein: ENSMUSP00000119990
Gene: ENSMUSG00000018381

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 49 8.8e-14 PFAM
low complexity region 87 106 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
low complexity region 140 183 N/A INTRINSIC
SH3 192 244 2.89e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150134
AA Change: E22V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000176538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit fractures, bowed long bones, osteomalacia, and scoliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Phospho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Phospho1 APN 11 95831083 missense probably damaging 0.99
IGL01950:Phospho1 APN 11 95828722 unclassified probably benign
IGL02676:Phospho1 APN 11 95830888 missense probably damaging 1.00
R1965:Phospho1 UTSW 11 95830879 missense probably damaging 1.00
R2019:Phospho1 UTSW 11 95831106 missense probably damaging 0.99
R6513:Phospho1 UTSW 11 95830687 missense possibly damaging 0.92
R7146:Phospho1 UTSW 11 95830906 missense probably damaging 1.00
R7652:Phospho1 UTSW 11 95830819 missense probably damaging 1.00
RF007:Phospho1 UTSW 11 95831055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCTCAGGTCTTGGATG -3'
(R):5'- AACAAATCGCCCATGCCTGG -3'

Sequencing Primer
(F):5'- TGGATGTGCCAGCGACC -3'
(R):5'- GCGACAGGGGGATGGTCTC -3'
Posted On2017-10-10