Incidental Mutation 'R6160:Enpp5'
ID489842
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 5
SynonymsD17Abb1e
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6160 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location44078813-44086567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44081368 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 229 (N229K)
Ref Sequence ENSEMBL: ENSMUSP00000122767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024756
AA Change: N229K

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: N229K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect possibly damaging
Transcript: ENSMUST00000154166
AA Change: N229K

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: N229K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTGGTTTACAGCCAAAGATC -3'
(R):5'- CACAGGCAAGTGTCTTGGAAAG -3'

Sequencing Primer
(F):5'- GTGGTTTACAGCCAAAGATCCCATC -3'
(R):5'- TTGGAAAGACCGCTGCTTAC -3'
Posted On2017-10-10