Incidental Mutation 'R6161:Ercc5'
ID489848
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 5
SynonymsXpg
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location44147744-44181260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44167352 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 475 (H475R)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
Predicted Effect probably benign
Transcript: ENSMUST00000027214
AA Change: H475R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: H475R

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155862
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7987:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATGCTGCTTGGAAGTGGG -3'
(R):5'- ATGTCTATCCCCTGATCAGAATGTG -3'

Sequencing Primer
(F):5'- CTTGGAAGTGGGCTGGAGC -3'
(R):5'- CCCTGATCAGAATGTGTTCTTG -3'
Posted On2017-10-10