Incidental Mutation 'R6161:Slc39a10'
ID 489849
Institutional Source Beutler Lab
Gene Symbol Slc39a10
Ensembl Gene ENSMUSG00000025986
Gene Name solute carrier family 39 (zinc transporter), member 10
Synonyms 2900042E17Rik
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock # R6161 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46807544-46892852 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46827407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 443 (T443M)
Ref Sequence ENSEMBL: ENSMUSP00000027131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027131]
AlphaFold Q6P5F6
Predicted Effect probably damaging
Transcript: ENSMUST00000027131
AA Change: T443M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: T443M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
low complexity region 224 244 N/A INTRINSIC
Pfam:Zip 406 607 9.9e-44 PFAM
Pfam:Zip 588 821 2.5e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141226
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Slc39a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Slc39a10 APN 1 46819057 splice site probably benign
IGL01628:Slc39a10 APN 1 46835523 missense probably benign 0.23
IGL01939:Slc39a10 APN 1 46832735 missense probably benign 0.07
IGL02068:Slc39a10 APN 1 46819439 splice site probably benign
IGL02093:Slc39a10 APN 1 46835209 missense probably damaging 1.00
IGL02101:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02122:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02125:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02171:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02175:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02186:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02699:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02700:Slc39a10 APN 1 46818128 missense probably damaging 1.00
R0217:Slc39a10 UTSW 1 46835540 missense probably benign
R0704:Slc39a10 UTSW 1 46835861 missense possibly damaging 0.76
R0782:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R1527:Slc39a10 UTSW 1 46819262 missense probably benign
R1566:Slc39a10 UTSW 1 46836085 missense possibly damaging 0.90
R1568:Slc39a10 UTSW 1 46826215 missense probably benign 0.00
R1664:Slc39a10 UTSW 1 46826109 missense probably damaging 1.00
R1830:Slc39a10 UTSW 1 46836070 missense probably damaging 1.00
R1954:Slc39a10 UTSW 1 46835174 missense possibly damaging 0.50
R2327:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R3434:Slc39a10 UTSW 1 46835717 missense probably benign
R3761:Slc39a10 UTSW 1 46812125 missense possibly damaging 0.88
R4035:Slc39a10 UTSW 1 46812074 missense probably damaging 1.00
R4419:Slc39a10 UTSW 1 46810066 missense probably benign 0.42
R4675:Slc39a10 UTSW 1 46817984 intron probably benign
R4689:Slc39a10 UTSW 1 46836013 missense probably benign 0.00
R5310:Slc39a10 UTSW 1 46836125 missense probably damaging 1.00
R6073:Slc39a10 UTSW 1 46832612 missense possibly damaging 0.68
R6199:Slc39a10 UTSW 1 46835833 missense probably damaging 1.00
R6562:Slc39a10 UTSW 1 46835564 missense probably benign 0.02
R7087:Slc39a10 UTSW 1 46835720 missense probably damaging 1.00
R7222:Slc39a10 UTSW 1 46819292 missense possibly damaging 0.82
R7286:Slc39a10 UTSW 1 46810070 missense probably damaging 0.97
R7568:Slc39a10 UTSW 1 46835130 missense probably benign 0.14
R7891:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
R7918:Slc39a10 UTSW 1 46835752 missense possibly damaging 0.88
RF020:Slc39a10 UTSW 1 46810015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTCCCATTTAAAACCCAATG -3'
(R):5'- AGATGGCGTATCTCCTTGACTC -3'

Sequencing Primer
(F):5'- AGAACATACAATTTAGCAAACTTGTG -3'
(R):5'- GGCGTATCTCCTTGACTCACTTATC -3'
Posted On 2017-10-10