Incidental Mutation 'R0528:Olfr441'
ID48985
Institutional Source Beutler Lab
Gene Symbol Olfr441
Ensembl Gene ENSMUSG00000094669
Gene Nameolfactory receptor 441
SynonymsMOR261-3, GA_x6K02T2P3E9-4442577-4441645
MMRRC Submission 038720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0528 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43106369-43117803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43116216 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 158 (H158L)
Ref Sequence ENSEMBL: ENSMUSP00000150572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095954] [ENSMUST00000204092] [ENSMUST00000213649]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095954
AA Change: H158L

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093648
Gene: ENSMUSG00000094669
AA Change: H158L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204092
AA Change: H158L
SMART Domains Protein: ENSMUSP00000144691
Gene: ENSMUSG00000073110
AA Change: H158L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213649
AA Change: H158L

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.3309 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T G 10: 80,003,014 W674G probably damaging Het
Abcc9 G A 6: 142,692,880 H103Y probably damaging Het
Ano7 A G 1: 93,395,502 N495S probably null Het
Ash1l A G 3: 88,982,277 N488D probably benign Het
Astn2 A G 4: 65,644,882 probably benign Het
Atraid T A 5: 31,052,452 probably benign Het
Baz2b T C 2: 59,936,739 R866G probably damaging Het
Cep164 T A 9: 45,776,936 probably benign Het
Clec4f G A 6: 83,652,794 Q261* probably null Het
Cpne4 A T 9: 104,686,441 N6Y probably damaging Het
Dhx38 G T 8: 109,562,661 Q36K probably benign Het
Dna2 C A 10: 62,958,131 Q341K probably benign Het
Dynap A G 18: 70,242,094 probably benign Het
Eif3l T C 15: 79,089,609 V408A probably benign Het
Foxi3 T A 6: 70,957,138 I203N probably damaging Het
Gcc2 T A 10: 58,298,689 L1495Q probably damaging Het
Gpr158 A G 2: 21,825,208 D688G probably damaging Het
Hcfc2 C A 10: 82,739,245 T246K probably damaging Het
Hdc C T 2: 126,616,232 E57K probably benign Het
Iqsec3 G C 6: 121,412,784 probably benign Het
Islr2 T A 9: 58,199,362 E205V probably damaging Het
Klf9 T C 19: 23,142,134 L127P probably benign Het
Lamc2 A T 1: 153,124,094 L1173Q probably damaging Het
Lipe G A 7: 25,398,476 T14I possibly damaging Het
Lnpep A G 17: 17,531,132 probably benign Het
Lrrc15 A G 16: 30,273,748 S258P probably damaging Het
Macc1 A T 12: 119,447,045 Y516F probably benign Het
Megf6 A G 4: 154,259,173 T718A probably benign Het
Myh1 A G 11: 67,220,619 D1628G probably damaging Het
Naca C T 10: 128,043,293 T1398I probably benign Het
Olfr1366 A G 13: 21,537,246 F238S possibly damaging Het
Padi4 A G 4: 140,769,429 V52A possibly damaging Het
Paqr5 G A 9: 61,956,245 T251I probably damaging Het
Pcm1 A G 8: 41,315,930 D1611G probably damaging Het
Prss12 G A 3: 123,482,796 R358K probably benign Het
Racgap1 A T 15: 99,628,706 H325Q probably damaging Het
Rbm12b1 A G 4: 12,145,657 H543R probably benign Het
Rc3h1 A T 1: 160,967,658 N1076I probably damaging Het
Rp1 A G 1: 4,344,865 L2008P possibly damaging Het
Rsph3a A G 17: 7,946,087 H93R possibly damaging Het
Sbf1 C T 15: 89,288,712 R1840H probably damaging Het
Soga1 A G 2: 157,020,692 L1439P probably damaging Het
Svs1 T A 6: 48,988,031 D324E probably benign Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbc1d9 T C 8: 83,210,456 S56P probably damaging Het
Tiam2 A T 17: 3,511,071 M1304L probably damaging Het
Tmprss11b G T 5: 86,671,894 R9S probably damaging Het
Tnfrsf21 T A 17: 43,037,614 I39N probably benign Het
Tnrc6b T C 15: 80,879,403 S369P probably benign Het
Tpra1 T C 6: 88,910,390 V217A probably benign Het
Uckl1 G C 2: 181,570,490 probably benign Het
Vmn1r199 A T 13: 22,382,566 Q10L probably benign Het
Vmn2r76 A G 7: 86,230,298 S265P possibly damaging Het
Vwa5b1 A T 4: 138,594,351 L377Q probably damaging Het
Wdr61 T A 9: 54,722,935 probably benign Het
Wrap73 A G 4: 154,145,319 D49G probably damaging Het
Zfp764 T A 7: 127,404,879 Q360L possibly damaging Het
Zfp846 G A 9: 20,587,928 probably benign Het
Zranb2 T C 3: 157,534,459 I14T probably benign Het
Other mutations in Olfr441
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0470:Olfr441 UTSW 6 43116624 missense probably null 0.04
R1441:Olfr441 UTSW 6 43115946 missense probably benign 0.02
R2048:Olfr441 UTSW 6 43116378 missense probably benign 0.00
R2191:Olfr441 UTSW 6 43116065 missense probably benign 0.13
R4438:Olfr441 UTSW 6 43116287 missense probably benign 0.09
R4465:Olfr441 UTSW 6 43115918 missense probably damaging 0.97
R5191:Olfr441 UTSW 6 43115866 missense probably damaging 1.00
R6353:Olfr441 UTSW 6 43116136 nonsense probably null
R6719:Olfr441 UTSW 6 43115973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTGCTTCCATAGAGTGCCTG -3'
(R):5'- AGAAAGCCTTTCTGCGACCTTCCC -3'

Sequencing Primer
(F):5'- CTTCCATAGAGTGCCTGATTTTAG -3'
(R):5'- CCCTGACTGGATTCTCAGGATG -3'
Posted On2013-06-12