Mutagenetix > Incidental Mutations

Incidental Mutation 'R6161:Notch1'

489855

Institutional Source

Beutler Lab

Gene Symbol

Notch1

Ensembl Gene

ENSMUSG00000026923

Gene Name

notch 1

Synonyms

Tan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1

MMRRC Submission

044308-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6161 (G1)

Quality Score

135.008

Status

Validated

Chromosome

Chromosomal Location

26457903-26516663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26468731 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1363 (C1363S)

Ref Sequence

ENSEMBL: ENSMUSP00000028288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]

AlphaFold

Q01705

PDB Structure

The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028288
AA Change: C1363S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: C1363S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EGF	23	58	1.63e1	SMART
EGF	62	99	4.29e-5	SMART
EGF	105	139	6.25e-7	SMART
EGF_CA	140	176	1.02e-6	SMART
EGF_CA	178	216	4.21e-13	SMART
EGF	221	255	6.7e-7	SMART
EGF_CA	257	293	6.8e-8	SMART
EGF_CA	295	333	1.16e-10	SMART
EGF_CA	335	371	3.17e-8	SMART
EGF	375	410	5.32e-1	SMART
EGF_CA	412	450	4.59e-14	SMART
EGF_CA	452	488	1.02e-11	SMART
EGF_CA	490	526	4.81e-8	SMART
EGF_CA	528	564	3.19e-13	SMART
EGF_CA	566	601	1.91e-11	SMART
EGF_CA	603	639	1.78e-11	SMART
EGF_CA	641	676	9.62e-8	SMART
EGF_CA	678	714	2.38e-12	SMART
EGF_CA	716	751	5.23e-9	SMART
EGF_CA	753	789	6.25e-7	SMART
EGF_CA	791	827	1.1e-11	SMART
EGF	832	867	2.03e-6	SMART
EGF_CA	869	905	5.73e-15	SMART
EGF_CA	907	943	4.56e-9	SMART
EGF_CA	945	981	1.64e-10	SMART
EGF_CA	983	1019	5.83e-7	SMART
EGF_CA	1021	1057	1.05e-13	SMART
EGF	1062	1095	8.12e-6	SMART
EGF	1100	1143	5.66e-5	SMART
EGF_CA	1145	1181	1.1e-11	SMART
EGF_CA	1183	1219	3.87e-12	SMART
EGF_CA	1221	1265	2.89e-11	SMART
EGF_CA	1267	1305	1.2e-8	SMART
EGF	1310	1346	5.74e-6	SMART
EGF	1351	1384	4.1e-2	SMART
EGF	1390	1426	2.66e-1	SMART
NL	1442	1480	4.08e-16	SMART
NL	1483	1522	1.08e-15	SMART
NL	1523	1562	7.39e-14	SMART
NOD	1566	1622	1.81e-32	SMART
NODP	1660	1722	3.27e-30	SMART
low complexity region	1729	1746	N/A	INTRINSIC
ANK	1870	1912	1.07e2	SMART
ANK	1917	1946	4.82e-3	SMART
ANK	1950	1980	6.71e-2	SMART
ANK	1984	2013	1.23e0	SMART
ANK	2017	2046	9.13e-4	SMART
ANK	2050	2079	2.97e-3	SMART
low complexity region	2205	2222	N/A	INTRINSIC
low complexity region	2364	2395	N/A	INTRINSIC
DUF3454	2453	2517	2.01e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123873

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129506

Predicted Effect

probably benign
Transcript: ENSMUST00000132820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140082

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147481

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148948

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183922

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Notch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Notch1	APN	2	26460046	missense	probably damaging	0.98
IGL01343:Notch1	APN	2	26472905	missense	probably benign	0.25
IGL02066:Notch1	APN	2	26460396	missense	possibly damaging	0.71
IGL02158:Notch1	APN	2	26460339	missense	probably damaging	1.00
IGL02541:Notch1	APN	2	26468503	missense	probably benign	0.12
IGL03280:Notch1	APN	2	26477874	intron	probably benign
IGL03338:Notch1	APN	2	26459959	missense	probably benign
Antero	UTSW	2	26476114	missense	possibly damaging	0.96
march	UTSW	2	26469899	missense	probably damaging	0.98
PIT4494001:Notch1	UTSW	2	26466473	missense	probably damaging	1.00
R0013:Notch1	UTSW	2	26473818	missense	possibly damaging	0.64
R0025:Notch1	UTSW	2	26470931	missense	probably damaging	1.00
R0129:Notch1	UTSW	2	26460458	missense	probably benign	0.06
R0285:Notch1	UTSW	2	26460861	missense	possibly damaging	0.88
R0531:Notch1	UTSW	2	26466572	missense	probably benign	0.00
R0747:Notch1	UTSW	2	26472140	missense	unknown
R1440:Notch1	UTSW	2	26480964	intron	probably benign
R1502:Notch1	UTSW	2	26484323	missense	possibly damaging	0.95
R1539:Notch1	UTSW	2	26472113	nonsense	probably null
R1623:Notch1	UTSW	2	26478612	missense	possibly damaging	0.88
R1844:Notch1	UTSW	2	26460434	missense	probably benign	0.12
R1863:Notch1	UTSW	2	26469950	missense	probably damaging	1.00
R1874:Notch1	UTSW	2	26481579	missense	possibly damaging	0.89
R1926:Notch1	UTSW	2	26481657	missense	probably damaging	1.00
R2156:Notch1	UTSW	2	26460861	missense	possibly damaging	0.91
R2196:Notch1	UTSW	2	26463804	nonsense	probably null
R2209:Notch1	UTSW	2	26460007	missense	probably benign
R2382:Notch1	UTSW	2	26473781	missense	probably benign	0.40
R2508:Notch1	UTSW	2	26465473	missense	possibly damaging	0.80
R2873:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R2874:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R3798:Notch1	UTSW	2	26478618	missense	probably benign	0.00
R4019:Notch1	UTSW	2	26481142	missense	probably benign	0.03
R4305:Notch1	UTSW	2	26477924	missense	probably damaging	1.00
R4334:Notch1	UTSW	2	26460036	missense	probably benign	0.22
R4504:Notch1	UTSW	2	26472177	missense	probably benign	0.16
R4624:Notch1	UTSW	2	26478081	missense	possibly damaging	0.94
R4659:Notch1	UTSW	2	26470889	missense	probably damaging	0.99
R4703:Notch1	UTSW	2	26471158	missense	probably benign
R4869:Notch1	UTSW	2	26471179	missense	probably benign	0.21
R4938:Notch1	UTSW	2	26474124	nonsense	probably null
R4989:Notch1	UTSW	2	26481181	missense	probably damaging	1.00
R5010:Notch1	UTSW	2	26476114	missense	possibly damaging	0.96
R5283:Notch1	UTSW	2	26468626	missense	probably damaging	1.00
R5303:Notch1	UTSW	2	26478619	missense	probably benign	0.01
R5635:Notch1	UTSW	2	26476161	missense	probably damaging	1.00
R5755:Notch1	UTSW	2	26473692	missense	probably benign	0.12
R5926:Notch1	UTSW	2	26476104	missense	probably benign	0.35
R5947:Notch1	UTSW	2	26462528	intron	probably benign
R6053:Notch1	UTSW	2	26472912	missense	probably benign	0.06
R6162:Notch1	UTSW	2	26462195	missense	probably benign
R6174:Notch1	UTSW	2	26485442	missense	possibly damaging	0.50
R6199:Notch1	UTSW	2	26469899	missense	probably damaging	0.98
R6209:Notch1	UTSW	2	26472805	missense	probably damaging	1.00
R6251:Notch1	UTSW	2	26474170	missense	possibly damaging	0.64
R6493:Notch1	UTSW	2	26472098	missense	unknown
R6723:Notch1	UTSW	2	26478106	missense	probably damaging	1.00
R6736:Notch1	UTSW	2	26460286	missense	probably benign	0.01
R7020:Notch1	UTSW	2	26481574	missense	possibly damaging	0.95
R7058:Notch1	UTSW	2	26463818	missense	probably benign	0.05
R7154:Notch1	UTSW	2	26459938	missense	probably benign
R7291:Notch1	UTSW	2	26476375	missense	probably benign	0.01
R7379:Notch1	UTSW	2	26479467	missense	probably damaging	1.00
R7560:Notch1	UTSW	2	26460165	missense	probably benign	0.43
R7610:Notch1	UTSW	2	26478179	missense	probably benign	0.13
R7833:Notch1	UTSW	2	26459533	makesense	probably null
R7988:Notch1	UTSW	2	26471001	missense	probably benign	0.00
R8493:Notch1	UTSW	2	26472239	missense	unknown
R8514:Notch1	UTSW	2	26472169	missense	probably damaging	1.00
R8523:Notch1	UTSW	2	26464905	missense	possibly damaging	0.82
R8677:Notch1	UTSW	2	26469924	missense	probably damaging	1.00
R8696:Notch1	UTSW	2	26477992	critical splice acceptor site	probably benign
R8833:Notch1	UTSW	2	26481603	missense	probably damaging	1.00
R8964:Notch1	UTSW	2	26481050	missense	possibly damaging	0.65
R9091:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9144:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9145:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9151:Notch1	UTSW	2	26477927	missense	probably benign	0.01
X0018:Notch1	UTSW	2	26462227	nonsense	probably null
X0066:Notch1	UTSW	2	26470335	missense	possibly damaging	0.90
Z1088:Notch1	UTSW	2	26477115	missense	probably damaging	0.99
Z1177:Notch1	UTSW	2	26460309	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGAATTTGGCAGGGCATAGAC -3'
(R):5'- GCAACCCTGACCATCCTATG -3'

Sequencing Primer
(F):5'- CAGCGGTAGAAAGGGTTCTC -3'
(R):5'- CCATCCTATGGTGAGATGTTTCAAG -3'

Posted On

2017-10-10