Mutagenetix > Incidental Mutations

Incidental Mutation 'R6161:Hao1'

489859

Institutional Source

Beutler Lab

Gene Symbol

Hao1

Ensembl Gene

ENSMUSG00000027261

Gene Name

hydroxyacid oxidase 1, liver

Synonyms

GOX, Gox1, Hao-1

MMRRC Submission

044308-MU

Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134497361-134554368 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 134505625 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 253 (D253E)

Ref Sequence

ENSEMBL: ENSMUSP00000028704 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028704]

Predicted Effect

probably benign
Transcript: ENSMUST00000028704
AA Change: D253E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261
AA Change: D253E

Domain	Start	End	E-Value	Type
Pfam:FMN_dh	15	362	9.1e-140	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Hao1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Hao1	APN	2	134554270	missense	probably damaging	0.99
IGL00886:Hao1	APN	2	134523159	missense	probably benign	0.00
IGL00954:Hao1	APN	2	134498261	missense	possibly damaging	0.87
IGL01472:Hao1	APN	2	134554230	missense	probably benign	0.04
IGL01570:Hao1	APN	2	134554200	missense	probably damaging	0.97
3-1:Hao1	UTSW	2	134500996	critical splice donor site	probably null
R0928:Hao1	UTSW	2	134505616	missense	possibly damaging	0.54
R0948:Hao1	UTSW	2	134530773	missense	probably damaging	1.00
R1204:Hao1	UTSW	2	134523027	nonsense	probably null
R1748:Hao1	UTSW	2	134498318	missense	possibly damaging	0.67
R1827:Hao1	UTSW	2	134530664	missense	probably benign	0.09
R1828:Hao1	UTSW	2	134530664	missense	probably benign	0.09
R1917:Hao1	UTSW	2	134523060	missense	probably benign	0.02
R2054:Hao1	UTSW	2	134498258	synonymous	silent
R2070:Hao1	UTSW	2	134530615	missense	probably damaging	1.00
R3831:Hao1	UTSW	2	134523005	missense	probably damaging	1.00
R3833:Hao1	UTSW	2	134523005	missense	probably damaging	1.00
R3960:Hao1	UTSW	2	134522983	critical splice donor site	probably null
R4509:Hao1	UTSW	2	134523044	missense	probably damaging	0.99
R4635:Hao1	UTSW	2	134523152	missense	probably damaging	1.00
R4662:Hao1	UTSW	2	134523027	nonsense	probably null
R4716:Hao1	UTSW	2	134505620	missense	probably damaging	1.00
R6374:Hao1	UTSW	2	134523104	missense	probably benign	0.14
R6799:Hao1	UTSW	2	134530765	missense	probably damaging	1.00
R6876:Hao1	UTSW	2	134501149	missense	probably benign	0.00
R7305:Hao1	UTSW	2	134548201	missense	probably benign	0.00
R7554:Hao1	UTSW	2	134530618	missense	possibly damaging	0.78
R7585:Hao1	UTSW	2	134501156	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGCGATATCACATAGCACC -3'
(R):5'- CAGTTCTGTCACATAATTACATTGC -3'

Sequencing Primer
(F):5'- TAGCACCACACATTTTACCATAAGTG -3'
(R):5'- GGATGAAGAAACCAGTACTAATACTC -3'

Posted On

2017-10-10